INT10597

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.78
First Reported 1992
Last Reported 2010
Negated 2
Speculated 2
Reported most in Body
Documents 27
Total Number 30
Disease Relevance 7.48
Pain Relevance 9.11

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

cytosol (Cyp19a1) endoplasmic reticulum (Cyp19a1) cytoplasm (Cyp19a1)
Anatomy Link Frequency
liver 2
cartilage 2
brain 2
temporomandibular joints 2
testis 2
Cyp19a1 (Rattus norvegicus)
Pain Link Frequency Relevance Heat
Snapping jaw 5 99.52 Very High Very High Very High
Hippocampus 44 99.42 Very High Very High Very High
Pain 211 99.36 Very High Very High Very High
Dismenorea 3 99.26 Very High Very High Very High
Morphine 583 99.00 Very High Very High Very High
endometriosis 9 99.00 Very High Very High Very High
Lasting pain 11 98.90 Very High Very High Very High
IPN 11 97.08 Very High Very High Very High
agonist 27 94.60 High High
Opioid 66 94.32 High High
Disease Link Frequency Relevance Heat
Targeted Disruption 13 100.00 Very High Very High Very High
Uterine Fibroids 3 99.64 Very High Very High Very High
Temporomandibular Joint Syndrome 5 99.52 Very High Very High Very High
Pain 222 99.36 Very High Very High Very High
Endometriosis 18 99.26 Very High Very High Very High
Disease 5 99.08 Very High Very High Very High
Gynecological Disease 3 98.72 Very High Very High Very High
Reprotox - General 1 4 97.56 Very High Very High Very High
Inflammatory Pain 11 97.08 Very High Very High Very High
Osteoporosis 42 94.80 High High

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
CONCLUSION: These results demonstrate that aromatase is expressed intensely in condylar cartilage and suggest that it may play an important role in pathophysiological mechanisms in condylar cartilage.


Gene_expression (expressed) of aromatase in cartilage
1) Confidence 0.78 Published 2006 Journal J Orofac Pain Section Body Doc Link 16708833 Disease Relevance 0 Pain Relevance 0
The effects of age and sex on the expression of aromatase in the rat temporomandibular joint.
Gene_expression (expression) of aromatase in temporomandibular joint associated with snapping jaw
2) Confidence 0.78 Published 2006 Journal J Orofac Pain Section Title Doc Link 16708833 Disease Relevance 0.10 Pain Relevance 0.10
The expression level of aromatase protein was also quantified by the density of aromatase-positive chondrocytes in TMJ condylar cartilage.
Gene_expression (expression) of aromatase protein in cartilage
3) Confidence 0.78 Published 2006 Journal J Orofac Pain Section Body Doc Link 16708833 Disease Relevance 0 Pain Relevance 0
METHODS: The expression of aromatase in terms of protein and mRNA was examined by immunohistochemistry, Western blot, and in situ hybridization in the TMJs of Sprague-Dawley rats.
Spec (examined) Gene_expression (expression) of aromatase
4) Confidence 0.78 Published 2006 Journal J Orofac Pain Section Body Doc Link 16708833 Disease Relevance 0 Pain Relevance 0
Ketoconazole had a significant production of both delta 4-androstenedione (delta 4-A) and E2 while it had a significant inhibition of DHT-production, thus this had a significant production of both aromatase and C17,20-lyase while had a significant inhibitory action of 5 alpha-reductase.
Gene_expression (production) of aromatase
5) Confidence 0.63 Published 1992 Journal J Toxicol Sci Section Abstract Doc Link 1507273 Disease Relevance 0.07 Pain Relevance 0.33
AIMS: To investigate the expression of aromatase in temporomandibular joints(TMJs) of male and female rats of different ages.
Spec (investigate) Gene_expression (expression) of aromatase in temporomandibular joints
6) Confidence 0.60 Published 2006 Journal J Orofac Pain Section Abstract Doc Link 16708833 Disease Relevance 0.07 Pain Relevance 0.07
The RNA concentration was measured with a NanoDrop ND-100 spectrophotometer. qRT-PCR was performed to monitor the gene expression levels of 5-alpha reductase type 1 and p450-aromatase.
Gene_expression (expression) of p450-aromatase
7) Confidence 0.50 Published 2010 Journal Mol Pain Section Body Doc Link PMC2978140 Disease Relevance 0 Pain Relevance 0.28
The peripheral expression of aromatase is widely distributed.
Gene_expression (expression) of aromatase
8) Confidence 0.50 Published 2010 Journal Mol Pain Section Body Doc Link PMC2978140 Disease Relevance 0.16 Pain Relevance 0.45
Primers were specifically designed between two adjacent exons (AutoPrime program) and the sequences used in this study were: for 5-alpha reductase, CGTCCTGCTGGCTATGTTTC (forward), GAAGGCCAAGACAAAGGTGA (reverse); for p450-aromatase, CGAGATCGAAATTCTGGTGGAAAAG (forward), TGCAAAATCCTACAGTCTTCCAGTT (reverse); for cyclophilin (housekeeping gene), ACACGCCATAATGGCACTGG (forward), ATTTGCCATGGACAAGATGCC (reverse).


Gene_expression (for) of p450-aromatase
9) Confidence 0.43 Published 2010 Journal Mol Pain Section Body Doc Link PMC2978140 Disease Relevance 0 Pain Relevance 0
In this experiment we study the mRNA expression of 5-alpha reductase type 1 (5aR-1) and p450-aromatase (AROM).
Gene_expression (expression) of p450-aromatase
10) Confidence 0.43 Published 2010 Journal Mol Pain Section Body Doc Link PMC2978140 Disease Relevance 0.21 Pain Relevance 0.45
The main result of the present experiment is that the expression of 5-alpha reductase type 1 (5aR-1) and p450-aromatase (AROM) in the male rat brain, liver and testis was strongly affected by inflammatory pain and morphine.
Gene_expression (expression) of p450-aromatase in testis associated with ipn and morphine
11) Confidence 0.39 Published 2010 Journal Mol Pain Section Body Doc Link PMC2978140 Disease Relevance 0.25 Pain Relevance 0.71
Aromatase and 5-alpha reductase gene expression: modulation by pain and morphine treatment in male rats

Background

Gene_expression (expression) of Aromatase associated with pain and morphine
12) Confidence 0.39 Published 2010 Journal Mol Pain Section Title Doc Link PMC2978140 Disease Relevance 0.19 Pain Relevance 0.95
The purpose of this study on male rats was to determine the effects of a single injection of morphine (5 mg/Kg) on persistent pain (formalin test) and the single or combined effects on p450-aromatase and 5-alpha reductase type 1 mRNA expression in the brain, liver and testis.
Gene_expression (expression) of p450-aromatase in testis associated with pain, lasting pain and morphine
13) Confidence 0.39 Published 2010 Journal Mol Pain Section Abstract Doc Link PMC2978140 Disease Relevance 0.17 Pain Relevance 0.95
Aromatase, the key enzyme for conversion of testosterone to estradiol, is expressed in hippocampal neurons of both genders (MacLusky et al., 1994; Wehrenberg et al., 2001), the effects of estradiol in males being largely unknown.
Gene_expression (expressed) of Aromatase in neurons
14) Confidence 0.37 Published 2010 Journal Frontiers in Behavioral Neuroscience Section Body Doc Link PMC3006668 Disease Relevance 0 Pain Relevance 0.15
In the case of testosterone, we could show at the individual level that tissue specific fluctuations are linked to learning task relevant behavior: While PFC concentrations of testosterone correlated mainly with the same parameters as serum testosterone, concentrations measured in the hippocampus, a region with neurosteroid production ability and rich aromatase activity, were linked in an opposite manner to RM performance in this final trial.
Gene_expression (production) of aromatase in hippocampus associated with hippocampus
15) Confidence 0.33 Published 2010 Journal Frontiers in Behavioral Neuroscience Section Body Doc Link PMC3006668 Disease Relevance 0 Pain Relevance 0.11
P450arom is also expressed in the eutopic endometria of patients with endometriosis, adenomyosis, and/or leiomyomas, whereas neither P450arom protein nor mRNA is expressed in the eutopic endometria of normal menstruating women with cervical carcinoma in situ yet showing no other gynecological disease (disease-free).
Neg (neither) Gene_expression (expressed) of P450arom associated with endometriosis, uterine fibroids, dismenorea, disease, gynecological disease and reprotox - general 1
16) Confidence 0.27 Published 1999 Journal Gynecol. Obstet. Invest. Section Abstract Doc Link 10559661 Disease Relevance 0.92 Pain Relevance 0.22
P450arom is also expressed in the eutopic endometria of patients with endometriosis, adenomyosis, and/or leiomyomas, whereas neither P450arom protein nor mRNA is expressed in the eutopic endometria of normal menstruating women with cervical carcinoma in situ yet showing no other gynecological disease (disease-free).
Neg (neither) Gene_expression (expressed) of P450arom associated with endometriosis, uterine fibroids, dismenorea, disease, gynecological disease and reprotox - general 1
17) Confidence 0.27 Published 1999 Journal Gynecol. Obstet. Invest. Section Abstract Doc Link 10559661 Disease Relevance 0.91 Pain Relevance 0.22
Examination of P450arom expression in endometrial biopsy specimens enables the physician to discriminate between the presence and absence of endometriosis, and may be used as an initial screening at outpatient infertility clinics.
Gene_expression (expression) of P450arom associated with endometriosis and reprotox - general 3
18) Confidence 0.27 Published 1999 Journal Gynecol. Obstet. Invest. Section Abstract Doc Link 10559661 Disease Relevance 1.06 Pain Relevance 0.22
Polymorphisms in the CYP17 gene (5' untranslated MspA1 polymorphism) and the CYP19 gene (G ?
Gene_expression (gene) of CYP19
19) Confidence 0.19 Published 2004 Journal Breast Cancer Res Section Body Doc Link PMC400670 Disease Relevance 0.14 Pain Relevance 0
There were no interactions between treatment group and CYP17 or CYP19 genotypes.


Gene_expression (genotypes) of CYP19
20) Confidence 0.19 Published 2004 Journal Breast Cancer Res Section Body Doc Link PMC400670 Disease Relevance 0.13 Pain Relevance 0

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox