INT107592

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.74
First Reported 2002
Last Reported 2010
Negated 1
Speculated 0
Reported most in Body
Documents 42
Total Number 47
Disease Relevance 11.16
Pain Relevance 1.13

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

cytosol (SMG1) nucleus (SMG1) response to stress (SMG1)
cytoplasm (SMG1)
Anatomy Link Frequency
neurons 14
lip 4
cleft 3
cerebrospinal fluid 1
lymphocyte 1
SMG1 (Homo sapiens)
Pain Link Frequency Relevance Heat
anesthesia 20 98.00 Very High Very High Very High
rheumatoid arthritis 12 93.24 High High
Multiple sclerosis 13 91.00 High High
Neuropathic pain 13 90.00 High High
Analgesic 11 89.36 High High
Anterior cingulate 15 82.40 Quite High
Central nervous system 3 82.16 Quite High
Pain 15 81.08 Quite High
depression 10 72.16 Quite High
adenocard 24 68.80 Quite High
Disease Link Frequency Relevance Heat
Attention Deficit Hyperactivity Disorder 400 100.00 Very High Very High Very High
Cleft Palate 294 100.00 Very High Very High Very High
Adhesions 42 100.00 Very High Very High Very High
Cancer 50 98.24 Very High Very High Very High
Recurrence 4 97.88 Very High Very High Very High
Adult Respiratory Distress Syndrome 23 95.36 Very High Very High Very High
Obesity 13 94.48 High High
Rheumatoid Arthritis 12 93.24 High High
Alzheimer's Dementia 12 92.20 High High
Demyelinating Disease 13 91.00 High High

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
Enhanced expression of ATX and specific receptors for LPA in numerous cancer cell types has created an interest in studying ATX as a potential chemotherapeutic target.
Gene_expression (expression) of ATX associated with cancer
1) Confidence 0.74 Published 2010 Journal Bioorg. Med. Chem. Section Abstract Doc Link 20005724 Disease Relevance 0.58 Pain Relevance 0.12
All of these tasks rely on the accumulation of spatial, temporal, and reward information [26–28], thus it has been proposed that LIP neurons function as neural integrators that accumulate information relevant for guiding behavior [29,30].
Gene_expression (neurons) of LIP in neurons
2) Confidence 0.60 Published 2007 Journal PLoS Biology Section Body Doc Link PMC1925133 Disease Relevance 0 Pain Relevance 0
Our task was designed not only to consider spatial selectivity of LIP neurons, but also to reduce the influence of task demands such as reward expectation and training.
Gene_expression (neurons) of LIP in neurons
3) Confidence 0.60 Published 2007 Journal PLoS Biology Section Body Doc Link PMC1925133 Disease Relevance 0 Pain Relevance 0
Our data also suggest that one subpopulation of LIP neurons was better described as systematically responding to number on a logarithmic scale.
Gene_expression (neurons) of LIP in neurons
4) Confidence 0.60 Published 2007 Journal PLoS Biology Section Body Doc Link PMC1925133 Disease Relevance 0 Pain Relevance 0
LIP was higher in the bupivacaine group (6.2 +/- 2.3 versus 3.6 +/- 0.6 cmH2O, p = 0.016, CI = -3.4 to -1.8).
Gene_expression (higher) of LIP
5) Confidence 0.58 Published 2007 Journal Sao Paulo Med J Section Body Doc Link 17505679 Disease Relevance 0 Pain Relevance 0
ATX expression has been implicated in development [4-6], and lymphocyte trafficking [7], and has been associated with a number of pathologies including adipose tissue metabolism [8], rheumatoid arthritis [9], Alzheimer type dementia [10], multiple sclerosis [11], neuropathic pain [12], and a growing list of cancer types [13].
Gene_expression (expression) of ATX in lymphocyte associated with multiple sclerosis, cancer, alzheimer's dementia, obesity, neuropathic pain and rheumatoid arthritis
6) Confidence 0.53 Published 2009 Journal Lipids Health Dis Section Body Doc Link PMC2649126 Disease Relevance 0.64 Pain Relevance 0.25
The PCR products were digested with HindIII and XbaI and subsequently ligated into pcDNA3.1 (+) to produce pcDNA3.1/HA-ATX
Gene_expression (produce) of ATX
7) Confidence 0.53 Published 2009 Journal Lipids Health Dis Section Body Doc Link PMC2649126 Disease Relevance 0 Pain Relevance 0
EK performed the mutagenesis, construction of vectors, and ATX expression.
Gene_expression (expression) of ATX
8) Confidence 0.53 Published 2009 Journal Lipids Health Dis Section Body Doc Link PMC2649126 Disease Relevance 0 Pain Relevance 0
Previous work has shown that at these eccentricities, RF widths in LIP exceed the dimensions of the stimuli used here [37,38].
Gene_expression (exceed) of LIP
9) Confidence 0.52 Published 2007 Journal PLoS Biology Section Body Doc Link PMC1925133 Disease Relevance 0 Pain Relevance 0
An antisense oligonucleotide primer was used to introduce the HA epitope tag (YPYDVPDYA) and an XbaI site into the C terminus of ATX:

(5'ATGCATGCTCTAGAATAGTCAGGAACATCGTATGGGTACTCGAGAATCTCGCTCTCATATGT3').

Gene_expression (introduce) of ATX
10) Confidence 0.46 Published 2009 Journal Lipids Health Dis Section Body Doc Link PMC2649126 Disease Relevance 0 Pain Relevance 0
It is plausible that the LPA-producing activity of ATX is regulated by its expression and by access to substrate(s).
Gene_expression (producing) of ATX
11) Confidence 0.41 Published 2009 Journal Lipids Health Dis Section Abstract Doc Link PMC2649126 Disease Relevance 0.16 Pain Relevance 0
Assays that rely on hydrolyses of artificial substrates (FS-3 and pNpTMP), or that rely on hydrolysis of cell-derived substrate, might fail to detect certain mutated forms of ATX that are nonetheless capable of producing LPA in the presence of sufficient exogenous substrate.
Gene_expression (producing) of ATX
12) Confidence 0.41 Published 2009 Journal Lipids Health Dis Section Abstract Doc Link PMC2649126 Disease Relevance 0 Pain Relevance 0
Many plasma cells and IgG-lambda type M-protein were detected in the cerebrospinal fluid.
Gene_expression (detected) of IgG-lambda type M-protein in cerebrospinal fluid
13) Confidence 0.41 Published 2002 Journal Rinsho Ketsueki Section Abstract Doc Link 12508488 Disease Relevance 0.59 Pain Relevance 0.12
Fig. 3B shows the relative hydrolytic activities of WT-ATX (30 ng ATX protein/reaction) and H226Q-ATX (360 ng ATX protein/reaction) as functions of FS-3 concentration, and Fig. 3C shows the relative hydrolytic activities of WT-ATX and H226Q-ATX (protein/reaction as in B) as functions of pNpTMP concentration.
Gene_expression (shows) of WT-ATX
14) Confidence 0.40 Published 2009 Journal Lipids Health Dis Section Body Doc Link PMC2649126 Disease Relevance 0 Pain Relevance 0
We therefore did not detect inhibition of WT-ATX LPC hydrolysis by H226Q-ATX at 4-fold excess.
Gene_expression (hydrolysis) of WT-ATX
15) Confidence 0.40 Published 2009 Journal Lipids Health Dis Section Body Doc Link PMC2649126 Disease Relevance 0.09 Pain Relevance 0
In the absence of exogenous LPC, WT-ATX produced its maximal response at the concentration of ATX used (0.23 ?
Gene_expression (used) of ATX
16) Confidence 0.40 Published 2009 Journal Lipids Health Dis Section Body Doc Link PMC2649126 Disease Relevance 0 Pain Relevance 0
Fig. 3B shows the relative hydrolytic activities of WT-ATX (30 ng ATX protein/reaction) and H226Q-ATX (360 ng ATX protein/reaction) as functions of FS-3 concentration, and Fig. 3C shows the relative hydrolytic activities of WT-ATX and H226Q-ATX (protein/reaction as in B) as functions of pNpTMP concentration.
Gene_expression (concentration) of WT-ATX
17) Confidence 0.40 Published 2009 Journal Lipids Health Dis Section Body Doc Link PMC2649126 Disease Relevance 0 Pain Relevance 0
In the absence of exogenous LPC, WT-ATX produced its maximal response at the concentration of ATX used (0.23 ?
Gene_expression (produced) of WT-ATX
18) Confidence 0.36 Published 2009 Journal Lipids Health Dis Section Body Doc Link PMC2649126 Disease Relevance 0 Pain Relevance 0
The mutant forms did not significantly stimulate migration responses at concentrations that produced a maximum response for WT-ATX, but this defect could be rescued by inclusion of exogenous LPC.


Gene_expression (produced) of WT-ATX
19) Confidence 0.36 Published 2009 Journal Lipids Health Dis Section Abstract Doc Link PMC2649126 Disease Relevance 0.05 Pain Relevance 0
The evidence in Figures 9 and 10 provides direct support for the view that the hypothesized LIP accumulator starts higher in the HL condition than in the LH condition, and that the drift rate of the accumulators is initially unaffected by the reward condition.
Gene_expression (hypothesized) of LIP accumulator
20) Confidence 0.28 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2824817 Disease Relevance 0 Pain Relevance 0

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox