INT11815

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.59
First Reported 1992
Last Reported 2010
Negated 3
Speculated 0
Reported most in Body
Documents 16
Total Number 16
Disease Relevance 4.81
Pain Relevance 2.83

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

extracellular space (Il2) extracellular region (Il2)
Anatomy Link Frequency
T cells 2
neuronal 1
fat 1
Filaments 1
thymocytes 1
Il2 (Mus musculus)
Pain Link Frequency Relevance Heat
cytokine 164 100.00 Very High Very High Very High
Morphine 20 99.78 Very High Very High Very High
Inflammation 116 99.74 Very High Very High Very High
tolerance 35 97.32 Very High Very High Very High
Demyelination 3 93.24 High High
Central nervous system 25 87.88 High High
Multiple sclerosis 14 86.84 High High
Antinociceptive 3 84.40 Quite High
Kinase C 21 75.56 Quite High
antagonist 6 75.04 Quite High
Disease Link Frequency Relevance Heat
INFLAMMATION 126 99.74 Very High Very High Very High
Aging 1 99.46 Very High Very High Very High
Apoptosis 14 99.32 Very High Very High Very High
Targeted Disruption 38 98.32 Very High Very High Very High
Disease 67 97.84 Very High Very High Very High
Diabetes Mellitus 29 97.08 Very High Very High Very High
Emphysema 10 96.92 Very High Very High Very High
Demyelinating Disease 4 93.24 High High
Nervous System Injury 2 92.80 High High
Cancer 11 91.88 High High

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
Additionally, neither UCM707 [N-(3-furanylmethyl)-5Z,8Z,11Z,14Z-eicosatetraenamide], the inhibitor of the putative anandamide membrane transporter (AMT), nor methyl arachidonoyl fluorophosphonate (MAFP), the inhibitor of fatty acid amidohydrolase (FAAH), were able to affect the inhibitory activity of anandamide upon interleukin-2.
Regulation (affect) of interleukin-2
1) Confidence 0.59 Published 2004 Journal J. Pharmacol. Exp. Ther. Section Abstract Doc Link 15284281 Disease Relevance 0.13 Pain Relevance 0.13
Subsequent studies showed that morphine treatment affected transcriptional control elements of the IL-2 promoter by inhibiting the synthesis of a specific trans-activating nuclear factor, c-Fos. c-Fos mRNA levels measured by semiquantitative RT-PCR were significantly decreased in thymocytes following treatment with morphine and activation with PHA and IL-1.
Regulation (affected) of IL-2 promoter in thymocytes associated with morphine
2) Confidence 0.58 Published 1997 Journal Cell. Immunol. Section Abstract Doc Link 9259765 Disease Relevance 0 Pain Relevance 0.68
Neither morphine nor antibodies to IL-2, IL-1 alpha, or the IL-1 receptor affected the entry of I-IL-2.
Neg (Neither) Regulation (affected) of IL-2 associated with morphine
3) Confidence 0.43 Published 1994 Journal Brain Res. Bull. Section Abstract Doc Link 8044683 Disease Relevance 0 Pain Relevance 0.34
An enhanced expression of calcineurin able to activate the transcriptional factor NFAT to regulate IL-2 and TNF?
Regulation (regulate) of IL-2
4) Confidence 0.31 Published 2007 Journal BMC Immunol Section Body Doc Link PMC2045662 Disease Relevance 0.22 Pain Relevance 0.03
On the other hand, Tregs are dependent on IL-2 for their growth and survival and can be eliminated by the use of neutralizing anti-IL-2 mAbs [40], [61], [62].
Regulation (dependent) of IL-2
5) Confidence 0.29 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2939396 Disease Relevance 0.33 Pain Relevance 0.09
METHOD: IL-2 was intraperitoneally injected in mice with induced SNI, and von Frey Filaments test and cold plate test were carried out to accesses the analgesic effects of IL-2 and the effect of naloxone in antagonizing the effects of IL-2.
Regulation (effects) of IL-2 in Filaments
6) Confidence 0.27 Published 2007 Journal Nan Fang Yi Ke Da Xue Xue Bao Section Body Doc Link 17715020 Disease Relevance 0.09 Pain Relevance 0
Mixtures of multiple antibiotics, morphine, and TPN solutions with and without 20% fat emulsion had no effect on interleukin-2 activity.
Neg (no) Regulation (effect) of interleukin-2 in fat associated with morphine
7) Confidence 0.27 Published 1992 Journal Am J Hosp Pharm Section Abstract Doc Link 1598936 Disease Relevance 0 Pain Relevance 0.26
We next targeted IL-2, a cytokine mainly produced by CD4+ T cells, whose role in help for CD8+ T cell responses remains controversial [32], [38].
Regulation (targeted) of IL-2 in T cell associated with cytokine
8) Confidence 0.18 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2939396 Disease Relevance 0.44 Pain Relevance 0.05
These results suggest that vitamin D3's ability to decrease the number of Treg cells may be the result of its inhibitory effect on the amount of IL-2 secreted by CD4+ T cells.


Regulation (effect) of IL-2 in T cells
9) Confidence 0.16 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2944871 Disease Relevance 0.08 Pain Relevance 0
-actin (5'- GTGGGCCGCTCTAGGCACCAA -3' and 5'- CTCTTTGATGTCACGCACGATTTC -3') as control primer, IL-2 (5'- TTCAAGCTCCACTTCAAGCTCTACAGCGGAAG -3' and 5'- GACAGAAGGCTATCCATCTCCTCAGAAAGTCC -3'), IFN-?
Regulation (control) of IL-2
10) Confidence 0.10 Published 2006 Journal Clin Mol Allergy Section Body Doc Link PMC1402316 Disease Relevance 0.25 Pain Relevance 0.11
We found a clear reduction in Th1 response (IL-2 and IFN-?)
Regulation (response) of IL-2
11) Confidence 0.10 Published 2005 Journal Respir Res Section Body Doc Link PMC555575 Disease Relevance 0.79 Pain Relevance 0.25
It has been recently shown that lupeol acetate presents an anti-inflammatory activity by regulating TNF-alpha and IL-2 specific mRNA, besides upregulating the synthesis of IL-10 mRNA [31].
Regulation (regulating) of IL-2 associated with inflammation
12) Confidence 0.09 Published 2010 Journal J Inflamm (Lond) Section Body Doc Link PMC3019217 Disease Relevance 0.81 Pain Relevance 0.34
Panels A and B in Figure 3 show the concentrations of the Th1 cytokines, IL-2 and IFN-?
Regulation (concentrations) of IL-2 associated with cytokine
13) Confidence 0.08 Published 2008 Journal BMC Immunol Section Body Doc Link PMC2584092 Disease Relevance 0 Pain Relevance 0.09
In addition to its importance in regulating neuronal Ca2+ homeostasis and Ca2+/CaM related signaling pathway, Ng has also been found to be down-regulated in vitamin A-deficient animals and aging animals, whereas it is up-regulated in cytokine IL-2 deprived T-cell apoptosis 12.
Regulation (regulated) of IL-2 in neuronal associated with aging, apoptosis and cytokine
14) Confidence 0.07 Published 2007 Journal International Journal of Biological Sciences Section Body Doc Link PMC1865092 Disease Relevance 0.63 Pain Relevance 0.17
The changes in IL-2 and eotaxin-1 suggest that alterations in T lymphocyte and eosinophil trafficking in the lung could be important factors affecting the stability of this disease.
Regulation (changes) of IL-2 in lung associated with disease
15) Confidence 0.05 Published 2009 Journal Respir Res Section Body Doc Link PMC2785783 Disease Relevance 0.82 Pain Relevance 0.09
and IL-2 mRNAs by rat splenocytes without altering actin (figure 2A).
Neg (without) Regulation (altering) of IL-2
16) Confidence 0.05 Published 2007 Journal PLoS ONE Section Body Doc Link PMC1790862 Disease Relevance 0.23 Pain Relevance 0.17

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox