INT132613

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.71
First Reported 2005
Last Reported 2010
Negated 5
Speculated 0
Reported most in Body
Documents 2
Total Number 19
Disease Relevance 5.90
Pain Relevance 4.15

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

cell proliferation (LGI1) extracellular space (LGI1) extracellular region (LGI1)
Anatomy Link Frequency
cerebellum 2
hippocampus 2
sciatic nerve 1
peripheral nerves 1
granule cell 1
LGI1 (Homo sapiens)
Pain Link Frequency Relevance Heat
potassium channel 1494 99.68 Very High Very High Very High
Hippocampus 126 99.68 Very High Very High Very High
Sciatic nerve 72 98.88 Very High Very High Very High
Pyramidal cell 36 97.84 Very High Very High Very High
Pain 83 94.92 High High
Pain threshold 1 75.00 Quite High
Multiple sclerosis 18 61.56 Quite High
imagery 36 55.60 Quite High
Neuropathic pain 36 34.48 Quite Low
hyperexcitability 36 5.00 Very Low Very Low Very Low
Disease Link Frequency Relevance Heat
Glioma 108 99.98 Very High Very High Very High
Syndrome 792 98.76 Very High Very High Very High
Limbic Encephalitis 486 98.34 Very High Very High Very High
Pain 84 94.92 High High
Disease 54 92.32 High High
Epilepsy 288 91.52 High High
Targeted Disruption 36 89.52 High High
Amnesia 72 87.36 High High
Confusion 72 86.64 High High
Convulsion 72 82.88 Quite High

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
In the cerebellum, Caspr2 (C and D) is expressed in the molecular (mol) and granule cell layers (GCL), but not in the pinceau (green arrows) where Kv1.1 (C) as well as Lgi1 (D) are strongly expressed.
Gene_expression (expressed) of Lgi1 in cerebellum
1) Confidence 0.71 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.08 Pain Relevance 0.22
To express Lgi1 fused to the transmembrane region of Caspr2, the C-terminal cDNA sequence of Caspr2 (residues 1248–1331) was amplified by polymerase chain reaction with the primers GATCCTCGAGGGACAAGGCCAAGCTATAAGAAATG and ATCGTTTAAACTCAAATGAGCCATTCCTTTTTGC.
Gene_expression (express) of Lgi1
2) Confidence 0.71 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0 Pain Relevance 0
Lgi1 was expressed strongly in the mossy fibre layer of the CA3-hippocampal subfield (Fig. 5B) as well as in the cerebellar pinceau (Fig. 5D), in a manner similar to Kv1.1 (Fig. 5A and C).
Gene_expression (expressed) of Lgi1
3) Confidence 0.71 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.10 Pain Relevance 0.22
Figure 5Expression pattern of Caspr2 and Lgi1 in the CNS.
Gene_expression (5Expression) of Lgi1
4) Confidence 0.71 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.08 Pain Relevance 0.21
Whereas Caspr2 is strongly associated with Kv1.1 and Kv1.2 at juxtaparanodes (Poliak et al., 2003), Lgi1 expression in peripheral nerves is weak but present (Ogawa et al., 2010; KA Kleopa, unpublished data).
Gene_expression (expression) of Lgi1 in peripheral nerves
5) Confidence 0.71 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.53 Pain Relevance 0.23
Clinical significance of Lgi1 and Caspr2 antibodies
Gene_expression (antibodies) of Lgi1
6) Confidence 0.61 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.87 Pain Relevance 0.11
The stop codon was removed by site directed mutagenesis using the primers GTTGACTTAAGCGCAGGACTCGAGGGACAAGG and CCTTGTCCCTCGAGTCCTGCGCTTAAGTCAAC, to give a final product of Lgi1 attached to the transmembrane and cytoplasmic domains (residues 1248–1331) of Caspr2.


Gene_expression (product) of Lgi1
7) Confidence 0.61 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0 Pain Relevance 0
Conversely, it is highly likely that some patients with limbic encephalitis or Morvan’s syndrome, previously negative for VGKC antibodies, will prove to have Lgi1 or Caspr2 antibodies.
Gene_expression (antibodies) of Lgi1 associated with syndrome, limbic encephalitis and potassium channel
8) Confidence 0.61 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.53 Pain Relevance 0.16
In E–G staining of sciatic nerve teased fibres with antibodies to the paranodal marker Caspr (distinct from Caspr2) and patient serum, shows that Caspr2-reactive Serum 6 strongly labels the juxtaparanodes that are known to express Caspr2 but not significantly Lgi1 (green arrows in E), whereas Lgi1-reactive Serum 1 (F), as well as a control serum (G), shows no specific binding.
Neg (not) Gene_expression (express) of Lgi1 in sciatic nerve associated with sciatic nerve
9) Confidence 0.55 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.37 Pain Relevance 0.12
To determine whether VGKC-antibodies bound to Lgi1, we expressed full-length Lgi1 in HEK293 cells.
Gene_expression (expressed) of Lgi1 associated with potassium channel
10) Confidence 0.55 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.28 Pain Relevance 0.23
Finally, we established a direct assay for Lgi1 antibodies by expressing Lgi1 fused on to the C terminal/transmembrane domain of Caspr2 so that it was anchored to the membrane.
Gene_expression (expressing) of Lgi1
11) Confidence 0.55 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0 Pain Relevance 0.13
Note that the red stain is found not only on the Lgi1/EGFP transfected cells, but also on the surface of non-transfected cells.
Gene_expression (transfected) of Lgi1
12) Confidence 0.55 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.15 Pain Relevance 0.24
In the cerebellum, Serum 6 (C) colocalizes with Caspr2 in the molecular (mol) and granule cell layers (GCL), but does not bind to the pinceau where Lgi1 is strongly expressed (red arrows in D) but Caspr2 is absent.
Neg (absent) Gene_expression (expressed) of Lgi1 in granule cell
13) Confidence 0.55 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.27 Pain Relevance 0.11
Since, we were unable to use EGFP-tagged Lgi1 in immunoprecipitation experiments (data not shown), perhaps because the EGFP-tag interfered with its conformation, to confirm the target of the VGKC-antibodies, we expressed Lgi1 fused to the C-terminal and transmembrane domain of Caspr2; this has provided a more direct and sensitive method for detection of patients’ antibodies and will now be developed for routine use.
Gene_expression (expressed) of Lgi1 associated with potassium channel
14) Confidence 0.55 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.24 Pain Relevance 0.05
Six sera (all Lgi1-antibody positive) bound with similar localization to that of antibodies to Lgi1, whereas two (both Caspr2-antibody positive) showed strong binding that was similar to that of antibodies to Caspr2 in both the hippocampus and cerebellum, as well as at the juxtaparanodes of teased sciatic nerve fibres (Fig. 6 and data not shown), which are known to express strongly Caspr2 (Poliak et al., 1999) but not significantly Lgi1 (data not shown).
Neg (not) Gene_expression (express) of Lgi1 in cerebellum associated with sciatic nerve and hippocampus
15) Confidence 0.55 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.17 Pain Relevance 0.31
Binding to the non-transfected cells was explained by the fact that Lgi1 could be detected in the medium of Lgi1-transfected cells (data not shown), consistent with its reported secretion (Fukata et al., 2006; Sireol-Piquer et al., 2006; Zhou et al., 2009) and this medium, but not that from other HEK293 supernatants, could transfer to untransfected HEK293 cells the ability to bind VGKC-antibodies (Supplementary Fig. 3).
Neg (not) Gene_expression (detected) of Lgi1 associated with potassium channel
16) Confidence 0.55 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.14 Pain Relevance 0.22
-dendrotoxin-labelled potassium channels in brain extracts: (i) contactin-associated protein-2 that is localized at the juxtaparanodes in myelinated axons; (ii) leucine-rich, glioma inactivated 1 protein that is most strongly expressed in the hippocampus; and (iii) Tag-1/contactin-2 that associates with contactin-associated protein-2.
Gene_expression (expressed) of inactivated 1 in hippocampus associated with hippocampus, potassium channel and glioma
17) Confidence 0.53 Published 2010 Journal Brain Section Abstract Doc Link PMC2929337 Disease Relevance 1.15 Pain Relevance 0.39
Six sera (all Lgi1-antibody positive) bound with similar localization to that of antibodies to Lgi1, whereas two (both Caspr2-antibody positive) showed strong binding that was similar to that of antibodies to Caspr2 in both the hippocampus and cerebellum, as well as at the juxtaparanodes of teased sciatic nerve fibres (Fig. 6 and data not shown), which are known to express strongly Caspr2 (Poliak et al., 1999) but not significantly Lgi1 (data not shown).
Neg (not) Gene_expression (express) of Lgi1 in hippocampus associated with sciatic nerve and hippocampus
18) Confidence 0.19 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.17 Pain Relevance 0.31
The assessed EPT were unbiased in both groups while individual variations were significant among the healthy volunteers but negligible among the patients in pain.
Gene_expression (unbiased) of EPT associated with pain
19) Confidence 0.18 Published 2005 Journal Physiother Theory Pract Section Abstract Doc Link 16392461 Disease Relevance 0.77 Pain Relevance 0.88

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox