INT143218

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.48
First Reported 2004
Last Reported 2009
Negated 0
Speculated 0
Reported most in Body
Documents 6
Total Number 7
Disease Relevance 0.41
Pain Relevance 4.50

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

plasma membrane (Gpr156) signal transducer activity (Gpr156)
Anatomy Link Frequency
nucleus accumbens 1
plasma 1
Gpr156 (Rattus norvegicus)
Pain Link Frequency Relevance Heat
Dopamine 82 99.68 Very High Very High Very High
Acupuncture 103 99.58 Very High Very High Very High
Gabapentin 101 99.52 Very High Very High Very High
imagery 23 99.10 Very High Very High Very High
Spinal cord 3 98.76 Very High Very High Very High
qutenza 15 97.64 Very High Very High Very High
Nucleus accumbens 46 97.56 Very High Very High Very High
pregabalin 200 95.48 Very High Very High Very High
dorsal root ganglion 76 93.92 High High
GABAergic 22 90.72 High High
Disease Link Frequency Relevance Heat
Ganglion Cysts 76 93.92 High High
Recurrence 3 92.56 High High
Opiate Addiction 10 89.96 High High
Apoptosis 50 50.00 Quite Low
Epilepsy 39 50.00 Quite Low
Bordatella Infection 9 15.40 Low Low
Convulsion 126 5.00 Very Low Very Low Very Low
Death 24 5.00 Very Low Very Low Very Low
Drug Dependence 24 5.00 Very Low Very Low Very Low
Pain 9 5.00 Very Low Very Low Very Low

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
However, the mechanisms that regulate GABAB receptor oligomerization at the plasma membrane remain largely unknown.
GABAB Binding (oligomerization) of in plasma
1) Confidence 0.48 Published 2007 Journal Eur. J. Neurosci. Section Abstract Doc Link 17425567 Disease Relevance 0 Pain Relevance 0.34
In these conditions, fluorescence lifetime imaging measurements further demonstrated a loss of interactions between green fluorescent protein-GABAB1b and t-dimer discosoma sp red fluorescent protein-GABAB2 subunits.
GABAB2 Binding (interactions) of associated with imagery
2) Confidence 0.31 Published 2007 Journal Eur. J. Neurosci. Section Abstract Doc Link 17425567 Disease Relevance 0 Pain Relevance 0.55
Subsequently, we studied the interactions between GABAB subunits after chronic stimulation of sensory fibres with capsaicin.
GABAB Binding (interactions) of associated with qutenza
3) Confidence 0.31 Published 2007 Journal Eur. J. Neurosci. Section Abstract Doc Link 17425567 Disease Relevance 0 Pain Relevance 0.41
The primers used were the following: GABAB1R forward primer 5'AATTGAATTCCGCTACCATCCAACAGACCA3'; GABAB1R reverse primer 5'AATTAAGCTTTCCTGTGACGTCATGTTGGAA3' PKA forward: 5'GTGGCAAGGAGTTTACTGAG3' PKA reverse: 5' CCAGTATCTGACTTTCCTGC 3' GAPDH forward: 5' GCCATCAATGACCCCTTCATT3' GAPDH reverse: 5'CGCCTGCTTCACCACCTTCTT3'.


GABAB1R Binding (primer) of
4) Confidence 0.13 Published 2009 Journal Mol Brain Section Body Doc Link PMC2706809 Disease Relevance 0 Pain Relevance 0.04
The primers used were the following: GABAB1R forward primer 5'AATTGAATTCCGCTACCATCCAACAGACCA3'; GABAB1R reverse primer 5'AATTAAGCTTTCCTGTGACGTCATGTTGGAA3' PKA forward: 5'GTGGCAAGGAGTTTACTGAG3' PKA reverse: 5' CCAGTATCTGACTTTCCTGC 3' GAPDH forward: 5' GCCATCAATGACCCCTTCATT3' GAPDH reverse: 5'CGCCTGCTTCACCACCTTCTT3'.


GABAB1R Binding (primer) of
5) Confidence 0.11 Published 2009 Journal Mol Brain Section Body Doc Link PMC2706809 Disease Relevance 0 Pain Relevance 0.04
In positive reinforcement, acupuncture treatment activates GABAB receptors on the dopamine cell bodies, resulting in a decrease of dopamine release in the nucleus accumbens through the inhibition of dopaminergic neurons; additionally, acupuncture activates presynaptic ?
GABAB Binding (receptors) of in nucleus accumbens associated with nucleus accumbens, dopamine and acupuncture
6) Confidence 0.05 Published 2008 Journal Evidence-based Complementary and Alternative Medicine : eCAM Section Body Doc Link PMC2529396 Disease Relevance 0.18 Pain Relevance 1.50
A recent study has also indicated that acting via G-protein coupled GABAB receptors, gabapentin selectively inhibited N-type Ca2+ channels in hippocampal pyramidal neurones [15].
GABAB Binding (coupled) of associated with gabapentin
7) Confidence 0.02 Published 2004 Journal BMC Pharmacol Section Body Doc Link PMC514605 Disease Relevance 0.23 Pain Relevance 1.61

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox