INT143219

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.37
First Reported 2007
Last Reported 2009
Negated 0
Speculated 0
Reported most in Body
Documents 2
Total Number 2
Disease Relevance 0
Pain Relevance 0.59

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

plasma membrane (Gpr156) signal transducer activity (Gpr156)
Gpr156 (Rattus norvegicus)
Pain Link Frequency Relevance Heat
imagery 2 99.26 Very High Very High Very High
qutenza 5 96.04 Very High Very High Very High
Spinal cord 1 86.00 High High
agonist 4 84.72 Quite High
Hippocampus 4 81.28 Quite High
GABAergic 4 68.32 Quite High
Electroencephalography 13 8.48 Low Low
gABA 5 5.00 Very Low Very Low Very Low
Central nervous system 4 5.00 Very Low Very Low Very Low
antagonist 3 5.00 Very Low Very Low Very Low
Disease Link Frequency Relevance Heat
Apoptosis 25 50.00 Quite Low
Epilepsy 19 50.00 Quite Low
Convulsion 63 5.00 Very Low Very Low Very Low
Death 12 5.00 Very Low Very Low Very Low
Fetal Alcohol Syndrome 4 5.00 Very Low Very Low Very Low
Neurological Disease 2 5.00 Very Low Very Low Very Low
Cognitive Disorder 2 5.00 Very Low Very Low Very Low
Hyperalgesia 1 5.00 Very Low Very Low Very Low
Anxiety Disorder 1 5.00 Very Low Very Low Very Low
Absence Epilepsy 1 5.00 Very Low Very Low Very Low

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
In these conditions, fluorescence lifetime imaging measurements further demonstrated a loss of interactions between green fluorescent protein-GABAB1b and t-dimer discosoma sp red fluorescent protein-GABAB2 subunits.
Negative_regulation (loss) of GABAB2 Binding (interactions) of associated with imagery
1) Confidence 0.37 Published 2007 Journal Eur. J. Neurosci. Section Abstract Doc Link 17425567 Disease Relevance 0 Pain Relevance 0.55
The primers used were the following: GABAB1R forward primer 5'AATTGAATTCCGCTACCATCCAACAGACCA3'; GABAB1R reverse primer 5'AATTAAGCTTTCCTGTGACGTCATGTTGGAA3' PKA forward: 5'GTGGCAAGGAGTTTACTGAG3' PKA reverse: 5' CCAGTATCTGACTTTCCTGC 3' GAPDH forward: 5' GCCATCAATGACCCCTTCATT3' GAPDH reverse: 5'CGCCTGCTTCACCACCTTCTT3'.


Negative_regulation (reverse) of GABAB1R Binding (primer) of
2) Confidence 0.15 Published 2009 Journal Mol Brain Section Body Doc Link PMC2706809 Disease Relevance 0 Pain Relevance 0.04

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox