INT14700

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.45
First Reported 1982
Last Reported 2011
Negated 9
Speculated 10
Reported most in Abstract
Documents 111
Total Number 121
Disease Relevance 66.16
Pain Relevance 21.52

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

Anatomy Link Frequency
lung 4
lymphocytes 3
macrophages 2
synovial fluid 2
anterior 2
IFNA1 (Homo sapiens)
Pain Link Frequency Relevance Heat
cytokine 1483 100.00 Very High Very High Very High
Inflammation 1094 100.00 Very High Very High Very High
Paracetamol 859 100.00 Very High Very High Very High
tolerance 33 100.00 Very High Very High Very High
Multiple sclerosis 882 99.84 Very High Very High Very High
narcan 10 99.76 Very High Very High Very High
ischemia 11 99.72 Very High Very High Very High
Potency 38 99.70 Very High Very High Very High
headache 30 99.44 Very High Very High Very High
corticosteroid 22 99.22 Very High Very High Very High
Disease Link Frequency Relevance Heat
Cancer 1386 100.00 Very High Very High Very High
INFLAMMATION 1243 100.00 Very High Very High Very High
Cold Sores 1076 100.00 Very High Very High Very High
Necrosis 143 100.00 Very High Very High Very High
Xerostomia 6 100.00 Very High Very High Very High
Hantavirus Infection 9 99.86 Very High Very High Very High
Demyelinating Disease 325 99.84 Very High Very High Very High
Disease 1300 99.80 Very High Very High Very High
Chronic Lymphoid Leukemia 12 99.78 Very High Very High Very High
Cv Unclassified Under Development 8 99.72 Very High Very High Very High

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
The effects of recombinant human interferon-alpha (IFN-alpha) and naloxone (NLX) were studied on the single neuron activities of the preoptic and anterior hypothalamus (PO/AH) and the ventromedial hypothalamus (VMH) in tissue slices.
Regulation (effects) of IFN-alpha in anterior associated with narcan
1) Confidence 0.45 Published 1987 Journal Neurosci. Lett. Section Abstract Doc Link 3696505 Disease Relevance 0 Pain Relevance 0.22
The effects of recombinant human interferon-alpha (IFN-alpha) and naloxone (NLX) were studied on the single neuron activities of the preoptic and anterior hypothalamus (PO/AH) and the ventromedial hypothalamus (VMH) in tissue slices.
Regulation (effects) of interferon-alpha in anterior associated with narcan
2) Confidence 0.45 Published 1987 Journal Neurosci. Lett. Section Abstract Doc Link 3696505 Disease Relevance 0 Pain Relevance 0.22
Interferon (IFN) is an effective agent in the treatment of chronic viral hepatitis C.
Regulation (effective) of Interferon associated with hepatitis virus infection
3) Confidence 0.45 Published 2007 Journal Dig. Dis. Sci. Section Abstract Doc Link 17318387 Disease Relevance 1.47 Pain Relevance 0.25
This is a review of the data on the safety and tolerance of interferon alfa-2a in the treatment of cancer patients and is particularly aimed at patient care.
Regulation (tolerance) of interferon associated with cancer and tolerance
4) Confidence 0.45 Published 1987 Journal Int. J. Cancer Suppl. Section Abstract Doc Link 3476474 Disease Relevance 0.47 Pain Relevance 0.08
Data on the effects of IFL-rA on lymphocyte subpopulations and peripheral blood mononuclear-cell surface beta 2-microglobulin are presented.
Regulation (effects) of IFL-rA in lymphocyte
5) Confidence 0.44 Published 1982 Journal JAMA Section Abstract Doc Link 6174742 Disease Relevance 0.56 Pain Relevance 0.10
Early stages of lymphoma disease are more responsive to IFN therapy, and this holds true also for chronic lymphocytic leukemia, in which IFN treatment is usually not effective in progressed disease after chemotherapy.
Regulation (responsive) of IFN associated with chronic lymphoid leukemia, lymphatic system cancer and disease
6) Confidence 0.44 Published 1990 Journal J. Invest. Dermatol. Section Abstract Doc Link 1701808 Disease Relevance 0.85 Pain Relevance 0.09
Early stages of lymphoma disease are more responsive to IFN therapy, and this holds true also for chronic lymphocytic leukemia, in which IFN treatment is usually not effective in progressed disease after chemotherapy.
Neg (not) Regulation (effective) of IFN associated with chronic lymphoid leukemia, lymphatic system cancer and disease
7) Confidence 0.44 Published 1990 Journal J. Invest. Dermatol. Section Abstract Doc Link 1701808 Disease Relevance 0.83 Pain Relevance 0.09
BACKGROUND: The authors reported previously the beneficial effects of interferon (IFN)-alpha/5-fluorouracil (5-FU) combination therapy for patients with advanced hepatocellular carcinoma (HCC) who have tumor thrombi in the major portal branches.
Regulation (effects) of IFN associated with cancer and hepatocellular cancer
8) Confidence 0.44 Published 2007 Journal Cancer Section Abstract Doc Link 17941012 Disease Relevance 0.67 Pain Relevance 0.15
A state of macrophage activation, in response to infectious agents, particularly Mycobacteria, involves IFN?
Regulation (involves) of IFN in macrophage
9) Confidence 0.44 Published 2010 Journal PPAR Research Section Body Doc Link PMC2796461 Disease Relevance 0.44 Pain Relevance 0.31
-actin (5'- GTGGGCCGCTCTAGGCACCAA -3' and 5'- CTCTTTGATGTCACGCACGATTTC -3') as control primer, IL-2 (5'- TTCAAGCTCCACTTCAAGCTCTACAGCGGAAG -3' and 5'- GACAGAAGGCTATCCATCTCCTCAGAAAGTCC -3'), IFN-?
Regulation (control) of IFN
10) Confidence 0.44 Published 2006 Journal Clin Mol Allergy Section Body Doc Link PMC1402316 Disease Relevance 0.25 Pain Relevance 0.11
[A case of chronic hepatitis C complicated by ischemia-like changes seen on the electrocardiogram during interferon treatment].
Regulation (seen) of interferon associated with chronic hepatitis and ischemia
11) Confidence 0.42 Published 1993 Journal Kokyu To Junkan Section Title Doc Link 8351443 Disease Relevance 1.35 Pain Relevance 0.47
The objective of the present study was to investigate the possible beneficial effect of IFN on these episodes.
Spec (possible) Regulation (effect) of IFN
12) Confidence 0.42 Published 1997 Journal Br. J. Rheumatol. Section Abstract Doc Link 9376975 Disease Relevance 0.60 Pain Relevance 0.26
CBDCA pharmacokinetics revealed a measured AUC of 3.61 versus a targeted AUC of 3, suggesting a possible effect of IFN on CBDCA levels versus errors in the estimation of CBDCA clearance using measured creatinine clearance.
Spec (possible) Regulation (effect) of IFN associated with disorders of creatine metabolism
13) Confidence 0.42 Published 2007 Journal Int. J. Gynecol. Cancer Section Abstract Doc Link 17362315 Disease Relevance 0.81 Pain Relevance 0.09
Until recently no randomized controlled trials of isoprinosine and interferon had been conducted.
Neg (no) Regulation (controlled) of interferon
14) Confidence 0.41 Published 2005 Journal BMC Pediatr Section Body Doc Link PMC1343569 Disease Relevance 0.31 Pain Relevance 0.03
In this case series we report the short-term prognosis, as well as the response to interferon (IFN) alpha and conventional treatment.
Regulation (response) of interferon
15) Confidence 0.40 Published 1996 Journal J. Peripher. Nerv. Syst. Section Abstract Doc Link 10975721 Disease Relevance 1.79 Pain Relevance 0.12
In this case series we report the short-term prognosis, as well as the response to interferon (IFN) alpha and conventional treatment.
Regulation (response) of IFN
16) Confidence 0.40 Published 1996 Journal J. Peripher. Nerv. Syst. Section Abstract Doc Link 10975721 Disease Relevance 1.79 Pain Relevance 0.12
IFN treatment adversely affected sexual health after allowing for age and gender.
Regulation (affected) of IFN
17) Confidence 0.38 Published 2003 Journal Hematol. J. Section Abstract Doc Link 12872150 Disease Relevance 1.04 Pain Relevance 0.08
A study that assessed the immunogenicity and safety of a human serum albumin-free formulation of im IFN beta-1a found the tolerability profile of the human serum albumin-free formulation similar to that of the original formulation.37

Future directions for the enhancement of adherence in MS

Regulation (formulation) of IFN associated with multiple sclerosis
18) Confidence 0.35 Published 2010 Journal Patient Prefer Adherence Section Body Doc Link PMC2819898 Disease Relevance 0.29 Pain Relevance 0.15
Half of the ethnic differences in response to interferon and ribavirin combination therapy can be explained by genetic polymorphism of IL28B [94].
Regulation (response) of interferon
19) Confidence 0.31 Published 2010 Journal Hepatitis Research and Treatment Section Body Doc Link PMC2990099 Disease Relevance 1.43 Pain Relevance 0
A randomized study compared the efficacy of corticosteroids, ibuprofen, and acetaminophen for the control of IFN beta-related flu-like symptoms.
Regulation (control) of IFN associated with paracetamol and corticosteroid
20) Confidence 0.30 Published 2010 Journal Patient Prefer Adherence Section Body Doc Link PMC2819898 Disease Relevance 0.33 Pain Relevance 0.48

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox