INT149985

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.75
First Reported 2003
Last Reported 2011
Negated 2
Speculated 2
Reported most in Body
Documents 32
Total Number 34
Disease Relevance 29.83
Pain Relevance 11.86

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

endosome (Tlr9) signal transduction (Tlr9) endoplasmic reticulum (Tlr9)
plasma membrane (Tlr9) intracellular (Tlr9) lysosome (Tlr9)
Anatomy Link Frequency
B cells 4
macrophages 3
T cells 3
lungs 2
dendritic cells 1
Tlr9 (Mus musculus)
Pain Link Frequency Relevance Heat
cytokine 433 100.00 Very High Very High Very High
Inflammatory response 82 100.00 Very High Very High Very High
rheumatoid arthritis 80 99.96 Very High Very High Very High
Morphine 547 99.76 Very High Very High Very High
Opioid 164 99.44 Very High Very High Very High
Inflammation 396 98.44 Very High Very High Very High
metalloproteinase 4 96.88 Very High Very High Very High
Arthritis 24 95.16 Very High Very High Very High
antagonist 12 94.48 High High
chemokine 127 86.88 High High
Disease Link Frequency Relevance Heat
Targeted Disruption 213 99.96 Very High Very High Very High
Rheumatoid Arthritis 80 99.96 Very High Very High Very High
Infection 620 99.84 Very High Very High Very High
Mycobacterial Infection 548 99.46 Very High Very High Very High
Systemic Lupus Erythematosus 208 99.40 Very High Very High Very High
Apoptosis 418 99.08 Very High Very High Very High
Increased Venous Pressure Under Development 20 99.08 Very High Very High Very High
Prion Diseases 26 98.88 Very High Very High Very High
INFLAMMATION 512 98.44 Very High Very High Very High
Disease 276 98.04 Very High Very High Very High

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
As shown in Fig. 1 B, the expression of TLR9 in the lungs was significantly enhanced after morphine treatment and H37Ra infection as detected by quantitative real time RT-PCR.
Gene_expression (expression) of TLR9 in lungs associated with infection and morphine
1) Confidence 0.75 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2824811 Disease Relevance 1.88 Pain Relevance 1.15
These results suggest a prominent role of morphine and H37Ra infection in the induction of TLR9 expression.


Gene_expression (expression) of TLR9 associated with infection and morphine
2) Confidence 0.75 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2824811 Disease Relevance 1.81 Pain Relevance 1.17
It has been shown that morphine increase the expression of TLR9 [24].
Gene_expression (expression) of TLR9 associated with morphine
3) Confidence 0.65 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2824811 Disease Relevance 2.46 Pain Relevance 1.11
We then examined the expression levels of proinflammatory cytokines in TLR9 KO and wild type mice following morphine administration and H37Ra infection.
Spec (examined) Gene_expression (expression) of TLR9 associated with targeted disruption, infection, morphine and cytokine
4) Confidence 0.65 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2824811 Disease Relevance 1.74 Pain Relevance 1.35
In this study, we show opioids through potent stimulus of TLR9-dependent proinflammatory cytokine production caused altered host resistance against M. tuberculosis in the mouse model.
Gene_expression (production) of TLR9-dependent associated with mycobacterial infection, opioid and cytokine
5) Confidence 0.65 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2824811 Disease Relevance 1.75 Pain Relevance 0.56
Their TLR9 expression and reactivity to CpG is reported to be greatly up-regulated by transforming growth factor (TGF-?)
Gene_expression (expression) of TLR9
6) Confidence 0.62 Published 2009 Journal Pharm Res Section Body Doc Link PMC2689355 Disease Relevance 0.42 Pain Relevance 0.08
CpG oligodeoxynucleotides up-taken by B cells and plasmacytoid dentritic cells (pDCs), which express Toll-like receptror 9 (TLR9) [10,11] initiate an immune stimulatory cascade that culminates in the indirect maturation, differentiation and proliferation of T cells and natural killer (NK) cells[12,13].
Gene_expression (express) of Toll-like receptror 9 in T cells
7) Confidence 0.60 Published 2004 Journal J Transl Med Section Body Doc Link PMC517950 Disease Relevance 0.58 Pain Relevance 0.16
CpG oligodeoxynucleotides up-taken by B cells and plasmacytoid dentritic cells (pDCs), which express Toll-like receptror 9 (TLR9) [10,11] initiate an immune stimulatory cascade that culminates in the indirect maturation, differentiation and proliferation of T cells and natural killer (NK) cells[12,13].
Gene_expression (express) of TLR9 in T cells
8) Confidence 0.60 Published 2004 Journal J Transl Med Section Body Doc Link PMC517950 Disease Relevance 0.58 Pain Relevance 0.16
Morphine and M. tuberculosis significantly induced the expression of Toll-like receptor 9 (TLR9), a key mediator of innate immunity and inflammation.
Gene_expression (expression) of TLR9 associated with mycobacterial infection, inflammation and morphine
9) Confidence 0.58 Published 2010 Journal PLoS ONE Section Abstract Doc Link PMC2824811 Disease Relevance 1.37 Pain Relevance 0.78
Morphine and M. tuberculosis significantly induced the expression of Toll-like receptor 9 (TLR9), a key mediator of innate immunity and inflammation.
Gene_expression (expression) of Toll-like receptor 9 associated with mycobacterial infection, inflammation and morphine
10) Confidence 0.58 Published 2010 Journal PLoS ONE Section Abstract Doc Link PMC2824811 Disease Relevance 1.37 Pain Relevance 0.78
We found that chronic morphine administration or H37Ra infection alone induced cell apoptosis in the lungs from wild type mice, but not in TLR9 deficient mice (Fig. 1A).
Gene_expression (deficient) of TLR9 in lungs associated with apoptosis, infection and morphine
11) Confidence 0.57 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2824811 Disease Relevance 2.13 Pain Relevance 1.03
The following primer pairs were used: for TLR9: CCCTGGTGTGGAACATCAT(forward) and GTTGGACAGGTGGACGAAGT (reverse); TNF-?
Gene_expression (for) of TLR9
12) Confidence 0.57 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2824811 Disease Relevance 0.19 Pain Relevance 0.03
In the lung, constitutive expression of TLR9 has been detected in endothelial cells and macrophages [8,9].
Gene_expression (expression) of TLR9 in endothelial cells
13) Confidence 0.52 Published 2009 Journal Respir Res Section Body Doc Link PMC2761862 Disease Relevance 0.59 Pain Relevance 0.18
Although at the site of application TLR9 is not constitutively expressed by the LCs, it is almost exclusively expressed by the keratinocytes in the upper and most differentiated layer of the epidermis.
Neg (not) Gene_expression (expressed) of TLR9 in keratinocytes
14) Confidence 0.47 Published 2009 Journal Pharm Res Section Body Doc Link PMC2689355 Disease Relevance 0.55 Pain Relevance 0.08
Upon recognition of CpG-rich sequences in the endosome, TLR9, expressed by B cells, macrophages, and dendritic cells (DCs), initiates a conserved TLR family signaling cascade that begins with the recruitment of the adaptor protein MyD88, resulting in NF-?
Gene_expression (expressed) of TLR9 in dendritic cells
15) Confidence 0.45 Published 2009 Journal Respir Res Section Body Doc Link PMC2761862 Disease Relevance 0.80 Pain Relevance 0.13
As evidence that the inflammasome response operates independently of other known DNA-sensing mechanisms, it was shown that, following exposure to adenovirus DNA, caspase-1 processing was intact in macrophages that lack both TLR9 and the TLR adaptor protein MyD88.
Neg (lack) Gene_expression (lack) of TLR9 in macrophages
16) Confidence 0.44 Published 2010 Journal Autoimmune Diseases Section Body Doc Link PMC2989704 Disease Relevance 0.15 Pain Relevance 0
PDC is thought to express TLR9 that is specialized to detect intracellular pathogens such as viruses and intracellular bacteria or parasites based on CpG motifs within their DNA.
Gene_expression (express) of TLR9
17) Confidence 0.43 Published 2009 Journal PLoS ONE Section Body Doc Link PMC2793013 Disease Relevance 0.37 Pain Relevance 0
As TLR9 molecules expressed by different species have diverged over evolutionary periods [10] the precise sequence motif (CpG dinucleotide plus flanking sequences) optimal for stimulating immune cells varies between species (Table 1).
Gene_expression (expressed) of TLR9 in immune cells
18) Confidence 0.40 Published 2008 Journal International Journal of Molecular Sciences Section Body Doc Link PMC2635754 Disease Relevance 0.24 Pain Relevance 0.20
In mice, immune cells of the myeloid lineage (monocytes, macrophages, myeloid DCs) express TLR9 whereas, in humans, memory B (but not naïve B cells) [92] and pDCs express TLR9 [12, 82, 88, 89, 91, 93].
Gene_expression (express) of TLR9 in B cells
19) Confidence 0.40 Published 2008 Journal International Journal of Molecular Sciences Section Body Doc Link PMC2635754 Disease Relevance 0.20 Pain Relevance 0.21
Cell populations expressing TLR9 also differ between species.
Gene_expression (expressing) of TLR9
20) Confidence 0.40 Published 2008 Journal International Journal of Molecular Sciences Section Body Doc Link PMC2635754 Disease Relevance 0.21 Pain Relevance 0.19

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox