INT175217

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.06
First Reported 2003
Last Reported 2010
Negated 0
Speculated 0
Reported most in Body
Documents 5
Total Number 5
Disease Relevance 0.44
Pain Relevance 0

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

cytosol (ENOPH1) small molecule metabolic process (ENOPH1) nucleus (ENOPH1)
cellular nitrogen compound metabolic process (ENOPH1) cellular_component (ENOPH1) cytoplasm (ENOPH1)
ENOPH1 (Homo sapiens)
Pain Link Frequency Relevance Heat
headache 4 5.00 Very Low Very Low Very Low
Neuritis 2 5.00 Very Low Very Low Very Low
cva 2 5.00 Very Low Very Low Very Low
Kinase C 1 5.00 Very Low Very Low Very Low
Eae 1 5.00 Very Low Very Low Very Low
Pain 1 5.00 Very Low Very Low Very Low
Disease Link Frequency Relevance Heat
Sprains And Strains 23 94.12 High High
Fever 34 74.24 Quite High
Confusion 3 60.88 Quite High
Disease 44 50.00 Quite Low
Togavirus Infection 16 50.00 Quite Low
Arthralgia 7 39.76 Quite Low
Infection 13 19.20 Low Low
Glycogen Storage Disease Type Vi 1 13.24 Low Low
Dengue 17 5.00 Very Low Very Low Very Low
Shock 5 5.00 Very Low Very Low Very Low

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
The other assay was a taqman probe-based RT-PCR protocol adapted from Pastorino et al. 2005, with slight modifications to the primers which target the E1 region (Table 1) and included following modifications to the PCR assay: PCR assay was performed using the Qiagen QuantiTect Probe RT-PCR kit, in a final reaction volume of 20 µl containing 5 µl of template, 1× of buffer mix, 0.2 µl of RT enzyme mix, 0.25 µM of probe, 0.25 µM and 0.4 µM of forward and reverse primers respectively.
Regulation (target) of E1
1) Confidence 0.06 Published 2010 Journal PLoS Neglected Tropical Diseases Section Body Doc Link PMC2907414 Disease Relevance 0.05 Pain Relevance 0
Meanwhile, for the 2004 data and the reduced-form logistic regression model, eigenvectors E1, E3, E10, E15 and E22 account for roughly 45% of the variance in the intercept DFBETA statistic, as do eigenvectors E1, E5, E14, E19, E21, E27 and E29 for the indicator variable DFBETA statistic.
Regulation (eigenvectors) of E1
2) Confidence 0.05 Published 2005 Journal Int J Health Geogr Section Body Doc Link PMC1215506 Disease Relevance 0 Pain Relevance 0
Control samples without
HSP70, E1, E2, E3, or GST-WT-Ub were also included. 
Regulation (Control) of E1
3) Confidence 0.03 Published 2003 Journal Biol Proced Online Section Body Doc Link PMC302190 Disease Relevance 0 Pain Relevance 0
The presence of CHIKV specific RNA in clinical samples was detected using the Access quick one-step RT-PCR kit (Promega, USA) employing a primers pair targeting the E1 gene (CHIK13: TTACATCACGTGCGAATAC genome position 10128-10146 and CHIK14: CTTTGCTCTCAGGCGTGCGACTTT genome position 10604-10627); designed from the nucleotide sequence of the reference S27 strain, GenBank Acc No.
Regulation (targeting) of E1 associated with sprains and strains
4) Confidence 0.01 Published 2009 Journal Virol J Section Body Doc Link PMC2774687 Disease Relevance 0.23 Pain Relevance 0
The 8 representative RT-PCR positive samples were again amplified through RT-PCR using a different set of primer targeting E1 gene (E1-10145F:ACAAAACCGTCATCCCGTCTC genome position 10145-10165, E1-11158R: TGACTATGTGGTCCTTCGGAGG genome position 11137-11158, E1-11011F:CGGGAAGCTGAGATAGAAGTTGAA Genome position 11011-11034, 3'NTR-11669R: TTGATTTTTATTAGTTTTATGTTT genome position 11645-11669) for sequencing and were subjected to double stranded sequencing employing Big dye terminator cycle sequencing ready reaction kit with ABI 310 sequencer (Applied Biosystems, USA).
Regulation (targeting) of E1
5) Confidence 0.01 Published 2009 Journal Virol J Section Body Doc Link PMC2774687 Disease Relevance 0.15 Pain Relevance 0

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox