INT176264
From wiki-pain
|
|
|
|
|
Sentences Mentioned In
Key: | Protein | Mutation | Event | Anatomy | Negation | Speculation | Pain term | Disease term |
Celenligil Nazlien et al. (2000) [47] investigated the localization of PCNA, which is a nuclear protein associated with the cell cycle in oral gingival epithelium and defined the age-related changes as to the PCNA-proliferative index (PI) in inflamed as well as healthy gingiva. | |||||||||||||||
| |||||||||||||||
|
To retrieve the antigen, sections were pretreated with 10 mM citrate buffer, pH 6.0, and autoclaved for 15 min at 120 °C, before immunohistochemical staining with proliferative cell nuclear antigen (PCNA) and chymase antibodies. | |||||||||||||||
| |||||||||||||||
|
Immunolabeling for the proliferating cell nuclear antigen (PCNA) was used to detect in situ cell proliferative activity in the ischemic mouse cortex. | |||||||||||||||
| |||||||||||||||
|
Cdc-6, which are regulated in response to mitogenic signals, binds PCNA and is required for initiation of DNA replication [34], was also repressed at both 12 and 24 hrs after NAC treatment, implying programs involving withdrawal of mitogenic factors as important mechanisms for NAC mediated inhibition of proliferation and increased differentiation in NHEK cells. | |||||||||||||||
| |||||||||||||||
|
One of the functions of p21 is to arrest cell proliferation by virtue of its association with PCNA (thereby eliminating the action of PCNA on transcription) and/or by its inhibition of cyclin/cdk association [4,17,18]. | |||||||||||||||
| |||||||||||||||
|
These data are consistent with the putative involvement of fetal testicular ghrelin and its functional receptor in the paracrine regulation of Leydig and germ cell development, possibly via interactions with SCF and PCNA.
| |||||||||||||||
| |||||||||||||||
|
DNTM1 localizes to replication foci [5], at least in part by interacting with proliferating cell nuclear antigen (PCNA), a protein closely involved in DNA replication. | |||||||||||||||
| |||||||||||||||
|
The data presented in Table 2 summarize the PCNA labeling indices and COX-2 scores for each group. | |||||||||||||||
| |||||||||||||||
|
At present, a large number of molecular factors have been shown to be associated with HCC invasion and metastasis, such as PCNA, MMP-9, VEGF, HGF and IL-6. | |||||||||||||||
| |||||||||||||||
|
As intervertebral space narrowed down, proliferating chordoblasts and denser packet chordocytes were revealed through toluidine blue staining and PCNA antibody binding, respectively. | |||||||||||||||
| |||||||||||||||
|
The binding of these inhibitors to spesific cyclin-dependent kinase [CDK] complexes blocks their activity and causes cell cycle arrest [11,12]. | |||||||||||||||
| |||||||||||||||
|
The p21WAF1/CIP1 is a cyclin kinase inhibitor that can induce cell growth arrest by inactivating cyclin-dependent kinase (Cdk) or by inhibiting the activity of proliferating cell nuclear antigen (PCNA). | |||||||||||||||
| |||||||||||||||
|
Samples were probed with antiserum directed specifically against GAD65/67, PCNA and ? | |||||||||||||||
| |||||||||||||||
|
Immunohistochemistry experiments confirmed these results, since all tumors sections analyzed displayed higher expression levels of the proliferating cell nuclear antigen (PCNA), a processivity factor for DNA polymerase ? | |||||||||||||||
| |||||||||||||||
|
Since p21/Waf-1 may prevent apoptosis by interacting with PCNA [51], we examined the expression of p21/Waf-1 in dissociated embryonic cortical cells that were exposed to sFasL, estrogen or both sFasL and estrogen for 12 hours. | |||||||||||||||
| |||||||||||||||
|
For example, PCNA and p21/Waf-1 bind to each other to prevent apoptosis induction [51], and to promote repair of double strand breaks in DNA, a characteristic of apoptosis. | |||||||||||||||
| |||||||||||||||
|
Genes study 1; GUCA2A: gggttgggaaactcaggaactttg, tacaggcagcgtaggcacag; PCNA: gccactccactctcttcaacgg, tggtgacagaaaagacttcagtatatgc; CD36: ggaatctgtcctattgggaaagtcactgc, ctgggttttcaactggagaggcaaagg; FOS: ctgtgtctcttttctctttctccttagtc, tccagcaccaggttaattccaataatg; DUSP1: agcagaggcgaagcatcatc, acggtggtggtggaggtg. | |||||||||||||||
| |||||||||||||||
|
Genes study 1; GUCA2A: gggttgggaaactcaggaactttg, tacaggcagcgtaggcacag; PCNA: gccactccactctcttcaacgg, tggtgacagaaaagacttcagtatatgc; CD36: ggaatctgtcctattgggaaagtcactgc, ctgggttttcaactggagaggcaaagg; FOS: ctgtgtctcttttctctttctccttagtc, tccagcaccaggttaattccaataatg; DUSP1: agcagaggcgaagcatcatc, acggtggtggtggaggtg. | |||||||||||||||
| |||||||||||||||
|
However, a recent nomenclature adjustment has grouped all human and murine kinases with sequence and functional similarity to Cdks into the Cdk family, even if cyclin binding has not been observed or is not expected [100]. | |||||||||||||||
| |||||||||||||||
|
For example, UL97 lacks conserved sequences for cyclin binding and appears to have cyclin-independent kinase activity. | |||||||||||||||
| |||||||||||||||
|
General Comments
This test has worked.