INT176264

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.21
First Reported 2004
Last Reported 2010
Negated 0
Speculated 0
Reported most in Body
Documents 21
Total Number 21
Disease Relevance 9.08
Pain Relevance 0.51

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

cell proliferation (PCNA) nucleoplasm (PCNA) nucleolus (PCNA)
nucleus (PCNA) DNA binding (PCNA) transcription factor binding (PCNA)
Anatomy Link Frequency
intervertebral space 1
germ cell 1
HGF 1
cortex 1
gingival epithelium 1
PCNA (Homo sapiens)
Pain Link Frequency Relevance Heat
aspirin 34 96.76 Very High Very High Very High
Inflammation 54 94.44 High High
withdrawal 2 94.12 High High
antagonist 16 66.96 Quite High
Glutamate 5 42.40 Quite Low
anesthesia 7 42.04 Quite Low
metalloproteinase 23 41.60 Quite Low
ischemia 8 41.56 Quite Low
cytokine 45 34.32 Quite Low
psoriasis 3 13.16 Low Low
Disease Link Frequency Relevance Heat
Metastasis 44 100.00 Very High Very High Very High
Hepatocellular Cancer 31 100.00 Very High Very High Very High
Apoptosis 240 99.92 Very High Very High Very High
Cleidocranial Dysplasia 29 98.72 Very High Very High Very High
Cancer 429 98.06 Very High Very High Very High
Stress 18 97.80 Very High Very High Very High
INFLAMMATION 66 94.44 High High
Hyperplasia 42 92.32 High High
Cirrhosis 1 88.56 High High
Skin Cancer 16 88.04 High High

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
Celenligil – Nazlien et al. (2000) [47] investigated the localization of PCNA, which is a nuclear protein associated with the cell cycle in oral gingival epithelium and defined the age-related changes as to the PCNA-proliferative index (PI) in inflamed as well as healthy gingiva.
PCNA Binding (associated) of in gingival epithelium
1) Confidence 0.21 Published 2010 Journal The Open Dentistry Journal Section Body Doc Link PMC2874215 Disease Relevance 0.63 Pain Relevance 0
To retrieve the antigen, sections were pretreated with 10 mM citrate buffer, pH 6.0, and autoclaved for 15 min at 120 °C, before immunohistochemical staining with proliferative cell nuclear antigen (PCNA) and chymase antibodies.
PCNA Binding (staining) of
2) Confidence 0.14 Published 2009 Journal Molecular Vision Section Body Doc Link PMC2763124 Disease Relevance 0.43 Pain Relevance 0
Immunolabeling for the proliferating cell nuclear antigen (PCNA) was used to detect in situ cell proliferative activity in the ischemic mouse cortex.
PCNA Binding (Immunolabeling) of in cortex
3) Confidence 0.13 Published 2010 Journal BMC Neurosci Section Body Doc Link PMC2974740 Disease Relevance 0.20 Pain Relevance 0
Cdc-6, which are regulated in response to mitogenic signals, binds PCNA and is required for initiation of DNA replication [34], was also repressed at both 12 and 24 hrs after NAC treatment, implying programs involving withdrawal of mitogenic factors as important mechanisms for NAC mediated inhibition of proliferation and increased differentiation in NHEK cells.
PCNA Binding (binds) of associated with withdrawal
4) Confidence 0.12 Published 2005 Journal BMC Cancer Section Body Doc Link PMC1182358 Disease Relevance 0.18 Pain Relevance 0.13
One of the functions of p21 is to arrest cell proliferation by virtue of its association with PCNA (thereby eliminating the action of PCNA on transcription) and/or by its inhibition of cyclin/cdk association [4,17,18].
PCNA Binding (association) of
5) Confidence 0.11 Published 2007 Journal BMC Nephrol Section Body Doc Link PMC2045080 Disease Relevance 0.28 Pain Relevance 0
These data are consistent with the putative involvement of fetal testicular ghrelin and its functional receptor in the paracrine regulation of Leydig and germ cell development, possibly via interactions with SCF and PCNA.


PCNA Binding (interactions) of in germ cell
6) Confidence 0.09 Published 2005 Journal Reprod Biol Endocrinol Section Body Doc Link PMC1291400 Disease Relevance 0.17 Pain Relevance 0
DNTM1 localizes to replication foci [5], at least in part by interacting with proliferating cell nuclear antigen (PCNA), a protein closely involved in DNA replication.
PCNA Binding (interacting) of
7) Confidence 0.09 Published 2005 Journal BMC Cancer Section Body Doc Link PMC1131894 Disease Relevance 0.31 Pain Relevance 0
The data presented in Table 2 summarize the PCNA labeling indices and COX-2 scores for each group.
PCNA Binding (summarize) of
8) Confidence 0.09 Published 2007 Journal BMC Cancer Section Body Doc Link PMC1899177 Disease Relevance 1.06 Pain Relevance 0.35
At present, a large number of molecular factors have been shown to be associated with HCC invasion and metastasis, such as PCNA, MMP-9, VEGF, HGF and IL-6.
PCNA Binding (associated) of in HGF associated with hepatocellular cancer and metastasis
9) Confidence 0.07 Published 2010 Journal J Transl Med Section Body Doc Link PMC2917410 Disease Relevance 1.08 Pain Relevance 0
As intervertebral space narrowed down, proliferating chordoblasts and denser packet chordocytes were revealed through toluidine blue staining and PCNA antibody binding, respectively.
PCNA Binding (binding) of in intervertebral space
10) Confidence 0.07 Published 2010 Journal BMC Physiol Section Body Doc Link PMC2909226 Disease Relevance 0.25 Pain Relevance 0
The binding of these inhibitors to spesific cyclin-dependent kinase [CDK] complexes blocks their activity and causes cell cycle arrest [11,12].
cyclin Binding (binding) of
11) Confidence 0.07 Published 2005 Journal BMC Cancer Section Body Doc Link PMC1208869 Disease Relevance 0.52 Pain Relevance 0
The p21WAF1/CIP1 is a cyclin kinase inhibitor that can induce cell growth arrest by inactivating cyclin-dependent kinase (Cdk) or by inhibiting the activity of proliferating cell nuclear antigen (PCNA).
PCNA Binding (activity) of
12) Confidence 0.06 Published 2008 Journal J Ovarian Res Section Body Doc Link PMC2584053 Disease Relevance 1.24 Pain Relevance 0
Samples were probed with antiserum directed specifically against GAD65/67, PCNA and ?
PCNA Binding (/) of
13) Confidence 0.05 Published 2004 Journal Reprod Biol Endocrinol Section Body Doc Link PMC416489 Disease Relevance 0.05 Pain Relevance 0
Immunohistochemistry experiments confirmed these results, since all tumors sections analyzed displayed higher expression levels of the proliferating cell nuclear antigen (PCNA), a processivity factor for DNA polymerase ?
PCNA Binding (factor) of associated with cancer
14) Confidence 0.05 Published 2009 Journal PLoS ONE Section Body Doc Link PMC2788417 Disease Relevance 1.22 Pain Relevance 0
Since p21/Waf-1 may prevent apoptosis by interacting with PCNA [51], we examined the expression of p21/Waf-1 in dissociated embryonic cortical cells that were exposed to sFasL, estrogen or both sFasL and estrogen for 12 hours.
PCNA Binding (interacting) of associated with apoptosis
15) Confidence 0.03 Published 2004 Journal BMC Neurosci Section Body Doc Link PMC395829 Disease Relevance 0.49 Pain Relevance 0
For example, PCNA and p21/Waf-1 bind to each other to prevent apoptosis induction [51], and to promote repair of double strand breaks in DNA, a characteristic of apoptosis.
PCNA Binding (bind) of associated with apoptosis
16) Confidence 0.03 Published 2004 Journal BMC Neurosci Section Body Doc Link PMC395829 Disease Relevance 0.53 Pain Relevance 0.03
Genes study 1; GUCA2A: gggttgggaaactcaggaactttg, tacaggcagcgtaggcacag; PCNA: gccactccactctcttcaacgg, tggtgacagaaaagacttcagtatatgc; CD36: ggaatctgtcctattgggaaagtcactgc, ctgggttttcaactggagaggcaaagg; FOS: ctgtgtctcttttctctttctccttagtc, tccagcaccaggttaattccaataatg; DUSP1: agcagaggcgaagcatcatc, acggtggtggtggaggtg.
PCNA Binding (ctgggttttcaactggagaggcaaagg) of
17) Confidence 0.03 Published 2008 Journal BMC Genomics Section Body Doc Link PMC2519092 Disease Relevance 0 Pain Relevance 0
Genes study 1; GUCA2A: gggttgggaaactcaggaactttg, tacaggcagcgtaggcacag; PCNA: gccactccactctcttcaacgg, tggtgacagaaaagacttcagtatatgc; CD36: ggaatctgtcctattgggaaagtcactgc, ctgggttttcaactggagaggcaaagg; FOS: ctgtgtctcttttctctttctccttagtc, tccagcaccaggttaattccaataatg; DUSP1: agcagaggcgaagcatcatc, acggtggtggtggaggtg.
PCNA Binding (agcagaggcgaagcatcatc) of
18) Confidence 0.03 Published 2008 Journal BMC Genomics Section Body Doc Link PMC2519092 Disease Relevance 0 Pain Relevance 0
However, a recent nomenclature adjustment has grouped all human and murine kinases with sequence and functional similarity to Cdks into the Cdk family, even if cyclin binding has not been observed or is not expected [100].
cyclin Binding (binding) of
19) Confidence 0.02 Published 2010 Journal PLoS Pathogens Section Body Doc Link PMC2936540 Disease Relevance 0.08 Pain Relevance 0
For example, UL97 lacks conserved sequences for cyclin binding and appears to have cyclin-independent kinase activity.
cyclin Binding (binding) of
20) Confidence 0.02 Published 2010 Journal PLoS Pathogens Section Body Doc Link PMC2936540 Disease Relevance 0.25 Pain Relevance 0

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox