INT184687

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.68
First Reported 2005
Last Reported 2005
Negated 0
Speculated 0
Reported most in Body
Documents 1
Total Number 6
Disease Relevance 1.04
Pain Relevance 0.90

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

Anatomy Link Frequency
hippocampus 3
spleen 1
cortex 1
Ccl19 (Mus musculus)
Pain Link Frequency Relevance Heat
Hippocampus 288 100.00 Very High Very High Very High
Central nervous system 30 5.00 Very Low Very Low Very Low
Inflammation 30 5.00 Very Low Very Low Very Low
chemokine 18 5.00 Very Low Very Low Very Low
anesthesia 12 5.00 Very Low Very Low Very Low
Inflammatory response 12 5.00 Very Low Very Low Very Low
depression 6 5.00 Very Low Very Low Very Low
Neurobehavioral 6 5.00 Very Low Very Low Very Low
gABA 6 5.00 Very Low Very Low Very Low
Kinase C 6 5.00 Very Low Very Low Very Low
Disease Link Frequency Relevance Heat
Hypersensitivity 24 97.56 Very High Very High Very High
Sprains And Strains 744 96.76 Very High Very High Very High
Aging 600 50.00 Quite Low
Dislocations 12 32.28 Quite Low
Disease 66 5.00 Very Low Very Low Very Low
INFLAMMATION 42 5.00 Very Low Very Low Very Low
Shock 36 5.00 Very Low Very Low Very Low
Death 24 5.00 Very Low Very Low Very Low
Cancer 24 5.00 Very Low Very Low Very Low
Syndrome 24 5.00 Very Low Very Low Very Low

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
It is possible that the novel downstream ATG identified in the Ccl19 transcript from the S8 hippocampus may provide a compensatory in-frame start site allowing expression of a truncated protein.
Transcription (transcript) of Ccl19 in hippocampus associated with hippocampus
1) Confidence 0.68 Published 2005 Journal Genome Biol Section Body Doc Link PMC1175968 Disease Relevance 0.15 Pain Relevance 0.33
A SacI-EcoRI 795-bp fragment of Grik1 was subsequently used as a control probe following the procedures described for Ccl19.


Transcription (described) of Ccl19
2) Confidence 0.66 Published 2005 Journal Genome Biol Section Body Doc Link PMC1175968 Disease Relevance 0.33 Pain Relevance 0
A fragment of the Ccl19 mRNA was amplified using RT-PCR from hippocampus total RNA.
Transcription (fragment) of Ccl19 in hippocampus associated with hippocampus
3) Confidence 0.66 Published 2005 Journal Genome Biol Section Body Doc Link PMC1175968 Disease Relevance 0.08 Pain Relevance 0.09
To create the Ccl19 probe, a fragment of the Ccl19 mRNA was amplified using RT-PCR from SR cortex total RNA (primers: GCGGGCTCACTGG-GGCACAC, TGGGAAGGTCCAGAGAACCAG).
Transcription (fragment) of Ccl19 in cortex
4) Confidence 0.66 Published 2005 Journal Genome Biol Section Body Doc Link PMC1175968 Disease Relevance 0.34 Pain Relevance 0.03
Because Ccl19 was one of several up-regulated genes located in proximity to one another and because sequence differences between S8 Ccl19 hippocampus and spleen mRNA suggested expression from at least two distinct genes, we hypothesized that a genomic duplication encompassing Ccl19 and surrounding genes was present within the S8 genome.
Transcription (hippocampus) of Ccl19 in hippocampus associated with hippocampus
5) Confidence 0.66 Published 2005 Journal Genome Biol Section Body Doc Link PMC1175968 Disease Relevance 0.08 Pain Relevance 0.23
Because Ccl19 was one of several up-regulated genes located in proximity to one another and because sequence differences between S8 Ccl19 hippocampus and spleen mRNA suggested expression from at least two distinct genes, we hypothesized that a genomic duplication encompassing Ccl19 and surrounding genes was present within the S8 genome.
Transcription (hippocampus) of Ccl19 in spleen associated with hippocampus
6) Confidence 0.22 Published 2005 Journal Genome Biol Section Body Doc Link PMC1175968 Disease Relevance 0.08 Pain Relevance 0.23

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox