INT187246

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.24
First Reported 2005
Last Reported 2008
Negated 0
Speculated 0
Reported most in Body
Documents 3
Total Number 11
Disease Relevance 1.17
Pain Relevance 1.84

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

peptidase activity (ADAMTS1) extracellular region (ADAMTS1)
Anatomy Link Frequency
tendons 2
cartilage 1
ADAMTS1 (Homo sapiens)
Pain Link Frequency Relevance Heat
Osteoarthritis 160 99.20 Very High Very High Very High
cytokine 105 99.06 Very High Very High Very High
Pain 126 97.44 Very High Very High Very High
Arthritis 4 95.20 Very High Very High Very High
metalloproteinase 92 94.20 High High
licofelone 78 58.08 Quite High
Mechanotransduction 9 5.36 Low Low
cINOD 8 5.00 Very Low Very Low Very Low
Inflammation 2 5.00 Very Low Very Low Very Low
Disease Link Frequency Relevance Heat
Osteoarthritis 160 99.20 Very High Very High Very High
Arthritis 6 95.20 Very High Very High Very High
Rupture 36 89.76 High High
Pain 9 88.56 High High
Tendinopathy 90 78.24 Quite High
Disease 12 5.00 Very Low Very Low Very Low
Necrosis 11 5.00 Very Low Very Low Very Low
Cancer 11 5.00 Very Low Very Low Very Low
Bone Cancer 9 5.00 Very Low Very Low Very Low
Targeted Disruption 9 5.00 Very Low Very Low Very Low

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
We noted previously (Jones et al., 2006) that ADAMTS-1 mRNA expression showed little variation between tendon tissue sample groups while ADAMTS-5 mRNA decreased in painful tendons, thus contrasting with the pattern of ADAMTS-4 mRNA expression.
Gene_expression (expression) of ADAMTS-1 mRNA in tendons associated with pain
1) Confidence 0.24 Published 2008 Journal Matrix Biol Section Body Doc Link PMC2443387 Disease Relevance 0 Pain Relevance 0.14
induced a transient decrease of ADAMTS-1 mRNA expression (Fig. 6C,D).
Gene_expression (expression) of ADAMTS-1 mRNA
2) Confidence 0.24 Published 2008 Journal Matrix Biol Section Body Doc Link PMC2443387 Disease Relevance 0 Pain Relevance 0.11
induced a transient decrease of ADAMTS-1 mRNA expression: a significant decrease at 6 h (64 ± 4% by TNF, 55 ± 5% by IL-1?)
Gene_expression (expression) of ADAMTS-1 mRNA
3) Confidence 0.24 Published 2008 Journal Matrix Biol Section Body Doc Link PMC2443387 Disease Relevance 0 Pain Relevance 0.12
None of EGF, FGF and PDGF had a significant effect on ADAMTS-1 mRNA expression (Fig. 6A), but each induced significant decreases in ADAMTS-5 mRNA levels (P < 0.01, except for PDGF P < 0.05), which were maintained over 48 h (Fig. 6C).
Gene_expression (expression) of ADAMTS-1 mRNA
4) Confidence 0.21 Published 2008 Journal Matrix Biol Section Body Doc Link PMC2443387 Disease Relevance 0 Pain Relevance 0.13
had contrasting effects on these two mRNA, inducing a small (2- to 3-fold) transient stimulation of ADAMTS-1 mRNA expression at 24 h (Fig. 6B) and a persistent decrease of ADAMTS-5 mRNA (Fig. 6D).


Gene_expression (expression) of ADAMTS-1 mRNA
5) Confidence 0.21 Published 2008 Journal Matrix Biol Section Body Doc Link PMC2443387 Disease Relevance 0 Pain Relevance 0.10
In contrast, the expression of ADAMTS-1 and -5 mRNA was lower in collagen gels compared with monolayers, and these mRNA showed smaller or opposite responses to growth factors and cytokines compared with that of ADAMTS-4 mRNA.
Gene_expression (expression) of ADAMTS-1 associated with cytokine
6) Confidence 0.19 Published 2008 Journal Matrix Biol Section Abstract Doc Link PMC2443387 Disease Relevance 0.15 Pain Relevance 0.22
Of these mRNA, ADAMTS-1 mRNA was expressed at highest levels but showed little difference between normal, painful and ruptured tendons, while ADAMTS-4 mRNA showed the largest change, increasing 8-fold in ruptured tendons (Jones et al., 2006).
Gene_expression (expressed) of ADAMTS-1 mRNA in tendons associated with pain
7) Confidence 0.19 Published 2008 Journal Matrix Biol Section Body Doc Link PMC2443387 Disease Relevance 0.18 Pain Relevance 0.30
Accession numbers, amplicons, forward primer (F), reverse primer (R) and probe (P) sequences were as follows:ADAMTS-1 (NM_006988; 77 bp):F =CCAGTGACCGGGATGCAR =ACATGTCTGGGACCCACACAP =TATGACACAGCAATTCTTTTCACCAGACAGGACADAMTS-4 (NM_005099; 83 bp):F =GCAACGTCAAGGCTCCTCTTR =CTCCACAAATCTACTCAGTGAAGCAP =AGACCCCGAAGAGCCAAGCGCTADAMTS-5 (XM_047802; 73 bp):F =AGGAGCACTACGATGCAGCTATCR =CCCAGGGTGTCACATGAATGP =TGCCCACATAAATCCTCCCGAGTAAACA
Gene_expression (follows) of ADAMTS-1
8) Confidence 0.18 Published 2008 Journal Matrix Biol Section Body Doc Link PMC2443387 Disease Relevance 0 Pain Relevance 0
also induced a small stimulation of ADAMTS-1 mRNA expression but decreased that of ADAMTS-5 (Fig. 6).
Gene_expression (expression) of ADAMTS-1 mRNA
9) Confidence 0.16 Published 2008 Journal Matrix Biol Section Body Doc Link PMC2443387 Disease Relevance 0 Pain Relevance 0
ADAMTS-1 and ADAMTS-5 are two enzymes that are constitutively expressed in both normal and OA cartilage.
Gene_expression (expressed) of ADAMTS-1 in cartilage associated with osteoarthritis
10) Confidence 0.03 Published 2005 Journal Arthritis Res Ther Section Body Doc Link PMC1257437 Disease Relevance 0.34 Pain Relevance 0.35
 ; in fact, this cytokine might, under certain conditions, downregulate ADAMTS-1 synthesis [31].
Gene_expression (synthesis) of ADAMTS-1 associated with cytokine
11) Confidence 0.03 Published 2005 Journal Arthritis Res Ther Section Body Doc Link PMC1257437 Disease Relevance 0.51 Pain Relevance 0.37

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox