
From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.75
First Reported 1990
Last Reported 2011
Negated 1
Speculated 0
Reported most in Body
Documents 39
Total Number 50
Disease Relevance 45.42
Pain Relevance 13.15

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

cytosol (Ccl3) extracellular space (Ccl3) extracellular region (Ccl3)
intracellular (Ccl3) cytoskeleton organization (Ccl3) kinase activity (Ccl3)
Anatomy Link Frequency
macrophage 8
T cells 3
microglia 2
granulocyte 2
plasma 1
Ccl3 (Mus musculus)
Pain Link Frequency Relevance Heat
chemokine 910 100.00 Very High Very High Very High
Inflammation 745 100.00 Very High Very High Very High
cytokine 332 100.00 Very High Very High Very High
Neuropathic pain 5 99.68 Very High Very High Very High
Multiple sclerosis 508 98.76 Very High Very High Very High
Nicotine 2 98.20 Very High Very High Very High
Angina 8 98.04 Very High Very High Very High
corticosteroid 16 97.04 Very High Very High Very High
Inflammatory response 94 96.08 Very High Very High Very High
Arthritis 57 90.52 High High
Disease Link Frequency Relevance Heat
INFLAMMATION 886 100.00 Very High Very High Very High
Neuropathic Pain 8 99.68 Very High Very High Very High
Respiratory Syncytial Virus 650 99.56 Very High Very High Very High
Cancer 801 99.48 Very High Very High Very High
Infection 387 99.40 Very High Very High Very High
Recurrence 130 99.24 Very High Very High Very High
Multiple Sclerosis 805 98.88 Very High Very High Very High
Demyelinating Disease 626 98.76 Very High Very High Very High
Acute Disease 16 98.68 Very High Very High Very High
Disease 400 98.64 Very High Very High Very High

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
Perineural injection of nicotine (20nmol), a macrophage suppressor, prevented PSL-induced neuropathic pain and suppressed MIP-1alpha and IL-1beta expressions.
Gene_expression (expressions) of MIP-1alpha in macrophage associated with nicotine and neuropathic pain
1) Confidence 0.75 Published 2010 Journal Pain Section Abstract Doc Link 20223588 Disease Relevance 0.81 Pain Relevance 1.01
CCL3 was produced biphasically, in both the early (day 1) and late (day 6–7) stages of infection.
Gene_expression (produced) of CCL3 associated with infection
2) Confidence 0.68 Published 2010 Journal PLoS ONE Section Abstract Doc Link PMC2827540 Disease Relevance 1.71 Pain Relevance 0.15
Furthermore circulating levels of CCL3 were significantly enhanced after AMI in mice (P=0.02), while CCR5(+) T-cell numbers were increased as well, suggestive of CCL3 driven T-cell homing towards the ischemic area.
Gene_expression (levels) of CCL3 in T-cell associated with myocardial infarction
3) Confidence 0.68 Published 2008 Journal J. Mol. Cell. Cardiol. Section Abstract Doc Link 18619972 Disease Relevance 1.29 Pain Relevance 0.60
The chemokine CCL3 (MIP1?)
Gene_expression (The) of CCL3 associated with chemokine
4) Confidence 0.67 Published 2010 Journal PLoS ONE Section Abstract Doc Link PMC2827540 Disease Relevance 1.37 Pain Relevance 0.11
The chemokine CCL3 (MIP1?)
Gene_expression (chemokine) of CCL3 associated with chemokine
5) Confidence 0.67 Published 2010 Journal PLoS ONE Section Abstract Doc Link PMC2827540 Disease Relevance 1.37 Pain Relevance 0.11
Significant increases in cytokines, such as interleukin (IL)-1beta, IL-6 and granulocyte macrophage colony stimulating factor (GM-CSF), and in chemokines, such as macrophage chemotactic protein 1 (MCP-1), macrophage inflammatory protein 1 (MIP-1alpha) and Kupffer cell derived chemokine (KC), were detected, with no changes in T-cell-derived cytokines.
Neg (no) Gene_expression (detected) of MIP-1alpha in Kupffer cell associated with chemokine, inflammation and cytokine
6) Confidence 0.65 Published 2007 Journal Neurogastroenterol. Motil. Section Abstract Doc Link 17509021 Disease Relevance 0.55 Pain Relevance 0.69
Levels of CCL3 were prospectively verified in 54 patients with unstable angina pectoris (UAP).
Gene_expression (Levels) of CCL3 associated with angina
7) Confidence 0.60 Published 2008 Journal J. Mol. Cell. Cardiol. Section Abstract Doc Link 18619972 Disease Relevance 1.36 Pain Relevance 0.66
In vitro, CCL3 is produced following RSV infection of airway epithelial cells [9].
Gene_expression (produced) of CCL3 in epithelial cells associated with infection and respiratory syncytial virus
8) Confidence 0.60 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2827540 Disease Relevance 2.04 Pain Relevance 0.21
Using intracellular staining to detect CCL3 in CD3+ T cells, following RSV peptide stimulation, a peak of CCL3 production was seen on day 7 p.i.
Gene_expression (production) of CCL3 in T cells associated with respiratory syncytial virus
9) Confidence 0.60 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2827540 Disease Relevance 1.24 Pain Relevance 0.04
Here we demonstrate that CCL3 was produced biphasically during RSV infection.
Gene_expression (produced) of CCL3 associated with infection and respiratory syncytial virus
10) Confidence 0.60 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2827540 Disease Relevance 0.91 Pain Relevance 0.15
However the levels of CCL3 measured in the BAL were at 4 pg/ml and the lowest level we used in the chemotaxis assay was 62.5 ng/ml.
Gene_expression (levels) of CCL3
11) Confidence 0.60 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2827540 Disease Relevance 0.67 Pain Relevance 0.08
The following primers and probe were used: CCL3, Forward primer: CATCGTTGACTATTTTGAAACCAG, Reverse primer: GCCGGTTTCTCTTAGTCAGGAA and probe 5?
Gene_expression (used) of CCL3
12) Confidence 0.59 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2827540 Disease Relevance 0.22 Pain Relevance 0.07
The beta-chemokines CCL5/regulated upon activation, normal T cell expressed and secreted, CCL3/macrophage inflammatory protein-1alpha, and CCL4/macrophage inflammatory protein-1beta were increased by 12-h exposure to HIV-1 Tat.
Gene_expression (expressed) of CCL3 in macrophage associated with chemokine, inflammation and acquired immune deficiency syndrome or hiv infection
13) Confidence 0.58 Published 2010 Journal J. Neurochem. Section Abstract Doc Link 20403075 Disease Relevance 0.82 Pain Relevance 0.56
There was no difference in cerebral CCL3 expression in WT mice before or after EAE induction (Figure 4C).
Gene_expression (expression) of CCL3 associated with multiple sclerosis
14) Confidence 0.57 Published 2008 Journal J Neuroinflammation Section Body Doc Link PMC2596102 Disease Relevance 1.17 Pain Relevance 0.30
Moreover, expression of CCL3 was similar in WT and gene-deficient mice subjected to EAE (Figure 4C).
Gene_expression (expression) of CCL3 associated with multiple sclerosis
15) Confidence 0.57 Published 2008 Journal J Neuroinflammation Section Body Doc Link PMC2596102 Disease Relevance 1.24 Pain Relevance 0.33
Interestingly, chemokines such as Cxcl9, Cxcl10, Cxcl11, Cxcl13, Ccl3, Ccl5 and Ccl12, Fc-receptor such as Fcer1g, and Mif genes were upregulated.
Gene_expression (genes) of Ccl3 associated with chemokine
16) Confidence 0.54 Published 2008 Journal BMC Genomics Section Body Doc Link PMC2440554 Disease Relevance 1.83 Pain Relevance 0.60
The significantly higher expression of neutrophils-related chemokine CCL3 seems to reveal a strong migration stimulus into the damaged area, which is limited by the lack of intact vasculature as discussed above.
Gene_expression (expression) of CCL3 in vasculature associated with chemokine
17) Confidence 0.54 Published 2011 Journal Journal of Biomedicine and Biotechnology Section Body Doc Link PMC2997608 Disease Relevance 0.47 Pain Relevance 0.31
Others included in Group II include CCL2, CCL3, CXCL1, CXCL9 and CXCL10, which are all chemokines implicated in inflammatory pathology in response to PVM infection.
Gene_expression (include) of CCL3 associated with chemokine, inflammation and infection
18) Confidence 0.54 Published 2010 Journal Virol J Section Body Doc Link PMC2993675 Disease Relevance 0.46 Pain Relevance 0.16
In lung homogenate there were also two peaks of CCL3 production on days 1 and 7 p.i.
Gene_expression (production) of CCL3 in lung
19) Confidence 0.53 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2827540 Disease Relevance 1.49 Pain Relevance 0.04
In contrast, the mRNA-expression of CCL3 showed a significantly stronger early induction in cryoinfarction and a second maximum after 3 days when compared to reperfused infarction (Figure 5(e)).
Gene_expression (expression) of CCL3 associated with infarction
20) Confidence 0.48 Published 2011 Journal Journal of Biomedicine and Biotechnology Section Body Doc Link PMC2997608 Disease Relevance 0.65 Pain Relevance 0.38

General Comments

This test has worked.

Personal tools
