INT221226

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.58
First Reported 2007
Last Reported 2010
Negated 3
Speculated 0
Reported most in Body
Documents 23
Total Number 25
Disease Relevance 1.69
Pain Relevance 4.84

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

mitochondrion (Kcnj8)
Anatomy Link Frequency
neurons 7
sensory neurons 2
brain 2
aorta 1
Neuronal 1
Kcnj8 (Rattus norvegicus)
Pain Link Frequency Relevance Heat
potassium channel 88 100.00 Very High Very High Very High
nociceptor 40 98.96 Very High Very High Very High
Central nervous system 37 97.36 Very High Very High Very High
opioid receptor 393 96.76 Very High Very High Very High
analgesia 60 93.40 High High
Pain 222 93.24 High High
Peripheral nerve injury 20 88.44 High High
Spinal nerve ligature 460 86.84 High High
Neurotransmitter 64 83.44 Quite High
anesthesia 81 80.76 Quite High
Disease Link Frequency Relevance Heat
Aids-related Complex 53 98.84 Very High Very High Very High
Nervous System Injury 180 88.44 High High
Pain 53 87.24 High High
Hypoxia 61 81.88 Quite High
Nociception 41 77.92 Quite High
Irritable Bowel Syndrome /

Irritable Bowel Syndrome Super / Visceral Pain

45 64.96 Quite High
Targeted Disruption 9 59.60 Quite High
Impaired Glucose Tolerance 18 55.16 Quite High
Ganglion Cysts 40 53.72 Quite High
Irritable Bowel Syndrome /

Irritable Bowel Syndrome Super

96 50.00 Quite Low

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
Two studies reported that antibodies against Kir6.1 and Kir6.2 detected proteins of the right size (about 45 kDa) in heart mitochondria, but no rigorous steps were taken to remove sarcolemmal contamination [166,195].
Gene_expression (detected) of Kir6.1 in heart
1) Confidence 0.58 Published 2007 Journal Biochimica et Biophysica Acta Section Body Doc Link PMC2212780 Disease Relevance 0 Pain Relevance 0.33
SUR1 and Kir6.2 were expressed in Caspr positive areas, indicating the presence of KATP channels in paranodal areas (Fig. 4M, Fig. 4P).
Gene_expression (expressed) of Kir6
2) Confidence 0.07 Published 2010 Journal Mol Pain Section Body Doc Link PMC2825500 Disease Relevance 0.06 Pain Relevance 0.14
Rat DRG neurons exhibit SUR1, SUR2, Kir6.2 but not Kir6.1 immunofluorescence (Fig. 2)
Gene_expression (neurons) of Kir6 in neurons
3) Confidence 0.06 Published 2010 Journal Mol Pain Section Body Doc Link PMC2825500 Disease Relevance 0 Pain Relevance 0
Expression of SUR1 and Kir6.2 subunits in peripheral nerve fibers from control rats (Fig. 4 and Fig. 5)
Gene_expression (subunits) of Kir6 in peripheral nerve
4) Confidence 0.06 Published 2010 Journal Mol Pain Section Body Doc Link PMC2825500 Disease Relevance 0.08 Pain Relevance 0.18
Neuronal plasmalemmal membrane stained for SUR1 (Fig. 2E), Kir6.2 (Fig. 2F), and SUR2 (Fig. 2G).
Gene_expression (stained) of Kir6 in Neuronal
5) Confidence 0.06 Published 2010 Journal Mol Pain Section Body Doc Link PMC2825500 Disease Relevance 0 Pain Relevance 0.07
However, neither immunostaining nor Western blots detected any Kir6.1 at the protein level.
Gene_expression (detected) of Kir6
6) Confidence 0.06 Published 2010 Journal Mol Pain Section Body Doc Link PMC2825500 Disease Relevance 0.15 Pain Relevance 0.19
However, the same antibodies did not fail to detect Kir6.1 in brain tissue, which was used as control, indicating competence of our antibodies, and, therefore the lack of translation of Kir6.1 mRNA to protein in DRG neurons.
Neg (fail) Gene_expression (detect) of Kir6 in neurons
7) Confidence 0.06 Published 2010 Journal Mol Pain Section Body Doc Link PMC2825500 Disease Relevance 0.13 Pain Relevance 0.16
Rat DRG neurons exhibit SUR1, SUR2, Kir6.2 but not Kir6.1 immunofluorescence (Fig. 2)
Gene_expression (Rat) of Kir6 in neurons
8) Confidence 0.06 Published 2010 Journal Mol Pain Section Body Doc Link PMC2825500 Disease Relevance 0 Pain Relevance 0
Rat DRG neurons exhibit SUR1, SUR2, Kir6.2 but not Kir6.1 immunofluorescence (Fig. 2)
Gene_expression (exhibit) of Kir6 in neurons
9) Confidence 0.06 Published 2010 Journal Mol Pain Section Body Doc Link PMC2825500 Disease Relevance 0 Pain Relevance 0
l using specific primers for Kir6.1 [forward (fw): GGATAATCCCATCGAGAGCA, reverse (rv): CTCAGCCACTGACCTTGTCA), Kir6.2 (fw: TCCAACAGCCCGCTCTAC, rv: CAGCGTTTTGTCCCCATC), SUR1 (fw: TGAAGCAACTGCCTCCATC, rv: GACAAGCCGGAAAAGCTTC) or SUR2 (fw: ACCTGCTCCAGCACAAGAAT, rv: CCTGGTCATTGTGATGAAGAGA)] and Taq DNA polymerase (Roche).
Gene_expression (using) of Kir6
10) Confidence 0.06 Published 2010 Journal Mol Pain Section Body Doc Link PMC2825500 Disease Relevance 0.05 Pain Relevance 0
However, the same antibodies did not fail to detect Kir6.1 in brain tissue, which was used as control, indicating competence of our antibodies, and, therefore the lack of translation of Kir6.1 mRNA to protein in DRG neurons.
Gene_expression (neurons) of Kir6 in neurons
11) Confidence 0.06 Published 2010 Journal Mol Pain Section Body Doc Link PMC2825500 Disease Relevance 0.12 Pain Relevance 0.14
Rat DRG neurons exhibit SUR1, SUR2, Kir6.2 but not Kir6.1 immunofluorescence (Fig. 2)
Gene_expression (immunofluorescence) of Kir6 in neurons
12) Confidence 0.06 Published 2010 Journal Mol Pain Section Body Doc Link PMC2825500 Disease Relevance 0 Pain Relevance 0
Protein expression for all but Kir6.1 was confirmed by Western blots and immunohistochemistry.
Gene_expression (expression) of Kir6
13) Confidence 0.06 Published 2010 Journal Mol Pain Section Abstract Doc Link PMC2825500 Disease Relevance 0.18 Pain Relevance 0.34
In positive controls, we obtained staining on samples from rat pancreas known to express Kir6.2/SUR1; brain known to express Kir6.2/SUR1 and Kir6.1/SUR1; heart and/or aorta, wherein Kir6.1/SUR2 is expressed [25] (data shown in Additional File 1: Figure S1).
Gene_expression (express) of Kir6 in brain
14) Confidence 0.06 Published 2010 Journal Mol Pain Section Body Doc Link PMC2825500 Disease Relevance 0 Pain Relevance 0
Using immunostaining and Western blots, we showed that peripheral sensory neurons express SUR1, SUR2 and Kir6.2 protein, but not Kir6.1 protein.
Neg (not) Gene_expression (express) of Kir6 in sensory neurons
15) Confidence 0.06 Published 2010 Journal Mol Pain Section Body Doc Link PMC2825500 Disease Relevance 0 Pain Relevance 0.51
In positive controls, we obtained staining on samples from rat pancreas known to express Kir6.2/SUR1; brain known to express Kir6.2/SUR1 and Kir6.1/SUR1; heart and/or aorta, wherein Kir6.1/SUR2 is expressed [25] (data shown in Additional File 1: Figure S1).
Gene_expression (expressed) of Kir6 in aorta
16) Confidence 0.06 Published 2010 Journal Mol Pain Section Body Doc Link PMC2825500 Disease Relevance 0 Pain Relevance 0
In positive controls, we obtained staining on samples from rat pancreas known to express Kir6.2/SUR1; brain known to express Kir6.2/SUR1 and Kir6.1/SUR1; heart and/or aorta, wherein Kir6.1/SUR2 is expressed [25] (data shown in Additional File 1: Figure S1).
Gene_expression (express) of Kir6 in brain
17) Confidence 0.06 Published 2010 Journal Mol Pain Section Body Doc Link PMC2825500 Disease Relevance 0 Pain Relevance 0
Either immunohistochemistry and Western blots were not sensitive enough to detect Kir6.1 protein in DRG neurons, or Kir6.1 mRNA is not translated into protein in these neurons [36,37].
Gene_expression (detect) of Kir6 in neurons
18) Confidence 0.06 Published 2010 Journal Mol Pain Section Body Doc Link PMC2825500 Disease Relevance 0.14 Pain Relevance 0.17
In positive controls, we obtained staining on samples from rat pancreas known to express Kir6.2/SUR1; brain known to express Kir6.2/SUR1 and Kir6.1/SUR1; heart and/or aorta, wherein Kir6.1/SUR2 is expressed [25] (data shown in Additional File 1: Figure S1).
Gene_expression (express) of Kir6 in pancreas
19) Confidence 0.06 Published 2010 Journal Mol Pain Section Body Doc Link PMC2825500 Disease Relevance 0 Pain Relevance 0
Using immunostaining and Western blots, we showed that peripheral sensory neurons express SUR1, SUR2 and Kir6.2 protein, but not Kir6.1 protein.
Neg (not) Gene_expression (express) of Kir6 in sensory neurons
20) Confidence 0.06 Published 2010 Journal Mol Pain Section Body Doc Link PMC2825500 Disease Relevance 0 Pain Relevance 0.51

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox