INT232209

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.75
First Reported 2008
Last Reported 2010
Negated 0
Speculated 0
Reported most in Body
Documents 2
Total Number 2
Disease Relevance 0.38
Pain Relevance 0

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

structural constituent of ribosome (Rplp0) ribosome (Rplp0) nucleus (Rplp0)
intracellular (Rplp0) ribosome biogenesis (Rplp0) cytoplasm (Rplp0)
Rplp0 (Mus musculus)
Pain Link Frequency Relevance Heat
agonist 4 19.24 Low Low
Inflammation 2 14.40 Low Low
cINOD 3 5.00 Very Low Very Low Very Low
aspirin 1 5.00 Very Low Very Low Very Low
anesthesia 1 5.00 Very Low Very Low Very Low
Disease Link Frequency Relevance Heat
Carcinoma 54 73.04 Quite High
Disease 8 66.36 Quite High
Targeted Disruption 17 60.44 Quite High
Noninfiltrating Intraductal Carcinoma 1 25.52 Quite Low
Diabetes Mellitus 2 22.92 Low Low
Cytomegalovirus Infection 1 22.64 Low Low
Dyslipidemia /

Combined Dyslipidemia

1 22.40 Low Low
INFLAMMATION 5 14.40 Low Low
Apoptosis 15 12.96 Low Low
Cancer 83 9.32 Low Low

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
Expression levels of acidic ribosomal phosphoprotein PO 36B4 have been shown to be estradiol independent [25], and the rat 36B4 transcript was used as the endogenous control using forward (AGCTTTGGGCATCACCACTA) and reverse (CTCCCACCTTGTCTCCAGTC) primers.
Gene_expression (Expression) of 36B4
1) Confidence 0.75 Published 2008 Journal Breast Cancer Res Section Body Doc Link PMC2374974 Disease Relevance 0.26 Pain Relevance 0
Expression levels of each mRNA were normalized to those of 36B4 mRNA.


Gene_expression (Expression) of 36B4
2) Confidence 0.65 Published 2010 Journal Nutr Metab (Lond) Section Body Doc Link PMC2882917 Disease Relevance 0.13 Pain Relevance 0

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox