INT236875

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.73
First Reported 2008
Last Reported 2010
Negated 0
Speculated 0
Reported most in Body
Documents 2
Total Number 2
Disease Relevance 0.80
Pain Relevance 0.11

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

cell differentiation (SRD5A1) small molecule metabolic process (SRD5A1) endoplasmic reticulum (SRD5A1)
cytoplasm (SRD5A1)
SRD5A1 (Homo sapiens)
Pain Link Frequency Relevance Heat
Central nervous system 1 57.60 Quite High
Onset of action 1 53.04 Quite High
Morphine 53 52.00 Quite High
Pain 20 50.00 Quite Low
Opioid 6 5.00 Very Low Very Low Very Low
opiate 2 5.00 Very Low Very Low Very Low
opioid receptor 2 5.00 Very Low Very Low Very Low
Analgesic 2 5.00 Very Low Very Low Very Low
Hippocampus 2 5.00 Very Low Very Low Very Low
Endogenous opioid 1 5.00 Very Low Very Low Very Low
Disease Link Frequency Relevance Heat
Lower Urinary Tract Symptoms 28 98.48 Very High Very High Very High
Benign Prostatic Hypertrophy 91 96.20 Very High Very High Very High
Overactive Bladder 40 55.44 Quite High
Pain 21 50.00 Quite Low
Disease 13 50.00 Quite Low
Disease Progression 6 48.40 Quite Low
Incontinence 2 33.32 Quite Low
Diuresis 6 32.56 Quite Low
Prostate Cancer 8 5.00 Very Low Very Low Very Low
Reprotox - General 1 5 5.00 Very Low Very Low Very Low

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
Current EAU guidelines focus on alpha-blockers and 5-alpha-reductase inhibitors (5ARIs), as monotherapies or in combination, when recommending medical therapy for BPH (4).
Localization (alpha-blockers) of 5-alpha-reductase associated with benign prostatic hypertrophy
1) Confidence 0.73 Published 2008 Journal International Journal of Clinical Practice Section Body Doc Link PMC2440415 Disease Relevance 0.80 Pain Relevance 0.06
Primers were specifically designed between two adjacent exons (AutoPrime program) and the sequences used in this study were: for 5-alpha reductase, CGTCCTGCTGGCTATGTTTC (forward), GAAGGCCAAGACAAAGGTGA (reverse); for p450-aromatase, CGAGATCGAAATTCTGGTGGAAAAG (forward), TGCAAAATCCTACAGTCTTCCAGTT (reverse); for cyclophilin (housekeeping gene), ACACGCCATAATGGCACTGG (forward), ATTTGCCATGGACAAGATGCC (reverse).


Localization (for) of 5-alpha reductase
2) Confidence 0.73 Published 2010 Journal Mol Pain Section Body Doc Link PMC2978140 Disease Relevance 0 Pain Relevance 0.05

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox