INT237099

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.17
First Reported 2008
Last Reported 2008
Negated 0
Speculated 0
Reported most in Body
Documents 1
Total Number 3
Disease Relevance 0.31
Pain Relevance 0

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

Iac (Mus musculus)
Pain Link Frequency Relevance Heat
Angina 3 5.00 Very Low Very Low Very Low
Disease Link Frequency Relevance Heat
Disease 3 92.48 High High
Cytomegalovirus Infection 3 92.16 High High
Aspergillus Infection 27 50.00 Quite Low
Invasive Pulmonary Aspergillosis 150 20.80 Low Low
Pneumonia 27 5.00 Very Low Very Low Very Low
Infection 27 5.00 Very Low Very Low Very Low
Fungal Infection 21 5.00 Very Low Very Low Very Low
Cancer 15 5.00 Very Low Very Low Very Low
Hematologic Neoplasms 9 5.00 Very Low Very Low Very Low
Candida Infection 6 5.00 Very Low Very Low Very Low

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
The IAC qPCR was developed based on a 105 base template derived from the jellyfish aequorin gene which has a sequence of 5'- GCCTGGTGCAAAAATTGCTTATCAAATTGAACGGTCAATTGGAAGTGGCGGAAGAACAGCTATTGCAAACGC
Gene_expression (developed) of IAC qPCR
1) Confidence 0.17 Published 2008 Journal BMC Infect Dis Section Body Doc Link PMC2440748 Disease Relevance 0 Pain Relevance 0
Because the IAC was added during the qPCR stage, it was unaffected by other variables of the process (like DNA extraction) and therefore it exclusively monitored inhibition in qPCR.
Gene_expression (added) of IAC
2) Confidence 0.15 Published 2008 Journal BMC Infect Dis Section Body Doc Link PMC2440748 Disease Relevance 0.18 Pain Relevance 0
It is also noteworthy to mention that the IAC qPCR multiplexed with the Aspergillus qPCR assay did not manifest any inhibition even in the presence of human genomic DNA as high as 1.5 ?
Gene_expression (multiplexed) of IAC qPCR
3) Confidence 0.15 Published 2008 Journal BMC Infect Dis Section Body Doc Link PMC2440748 Disease Relevance 0.12 Pain Relevance 0

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox