INT242889

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.36
First Reported 2008
Last Reported 2010
Negated 1
Speculated 0
Reported most in Body
Documents 15
Total Number 17
Disease Relevance 7.37
Pain Relevance 0.69

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

RNA binding (SPI1) nucleus (SPI1)
Anatomy Link Frequency
fibroblast 1
MNCs 1
SPI1 (Homo sapiens)
Pain Link Frequency Relevance Heat
Inflammation 262 98.16 Very High Very High Very High
COX2 6 96.52 Very High Very High Very High
Pain 5 90.00 High High
Inflammatory mediators 11 76.88 Quite High
Inflammatory response 45 64.08 Quite High
ischemia 33 59.32 Quite High
cINOD 11 25.60 Quite Low
cytokine 17 5.00 Very Low Very Low Very Low
visual analogue scale 12 5.00 Very Low Very Low Very Low
metalloproteinase 11 5.00 Very Low Very Low Very Low
Disease Link Frequency Relevance Heat
Decubitus Ulcers 492 100.00 Very High Very High Very High
Diabetes Mellitus 187 99.60 Very High Very High Very High
Esophageal Disease 72 98.60 Very High Very High Very High
INFLAMMATION 329 98.16 Very High Very High Very High
Death 13 95.64 Very High Very High Very High
Stomach Cancer 2 91.48 High High
Pain 5 90.00 High High
Atherosclerosis 88 88.64 High High
Insulin Resistance 110 87.84 High High
Systemic Lupus Erythematosus 11 80.56 Quite High

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
This promoter variant disrupts a Sp1/Sp3 transcription factor binding site and causes a decrease in transcriptional activity in lung fibroblast cells [22], [23].
Sp1 Binding (factor binding site) of in fibroblast
1) Confidence 0.36 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2928273 Disease Relevance 0.64 Pain Relevance 0.15
However, this same variant, while altering the Sp1/Sp3 site, also introduces a binding site for another transcription factor, Egr-1, although the consequences are unknown [22].
Sp1 Binding (altering) of
2) Confidence 0.36 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2928273 Disease Relevance 0.66 Pain Relevance 0.17
PU.1 DNA binding was adjusted to Oct-1 DNA binding.


PU.1 Binding (binding) of
3) Confidence 0.08 Published 2008 Journal Diabetes Care Section Body Doc Link PMC2518353 Disease Relevance 0 Pain Relevance 0
There was no change in TLR expression or DNA binding by PU.1 following dextrose or saline infusion in the control groups.
PU.1 Binding (binding) of
4) Confidence 0.08 Published 2008 Journal Diabetes Care Section Abstract Doc Link PMC2518353 Disease Relevance 0.37 Pain Relevance 0.05
The DNA binding of PU.1, a major transcription factor regulating many TLR genes, was concomitantly suppressed by 24 ± 10% (P < 0.05) by 4 h in MNCs.
PU.1 Binding (binding) of in MNCs
5) Confidence 0.08 Published 2008 Journal Diabetes Care Section Abstract Doc Link PMC2518353 Disease Relevance 0.41 Pain Relevance 0.06
PU.1 DNA binding activity
PU.1 Binding (activity) of
6) Confidence 0.08 Published 2008 Journal Diabetes Care Section Body Doc Link PMC2518353 Disease Relevance 0 Pain Relevance 0
PU.1 DNA binding activity
PU.1 Binding (binding) of
7) Confidence 0.08 Published 2008 Journal Diabetes Care Section Body Doc Link PMC2518353 Disease Relevance 0 Pain Relevance 0
PU.1 DNA binding was adjusted to Oct-1 DNA binding.


PU.1 Binding (binding) of
8) Confidence 0.08 Published 2008 Journal Diabetes Care Section Body Doc Link PMC2518353 Disease Relevance 0 Pain Relevance 0
Nuclear PU.1 DNA binding activity was measured by an electromobility shift assay.
PU.1 Binding (binding) of
9) Confidence 0.07 Published 2008 Journal Diabetes Care Section Body Doc Link PMC2518353 Disease Relevance 0 Pain Relevance 0
PU.1 is the transcription factor that binds to a purine-rich region of the TLR gene promoters in order to activate the transcription of TLRs (17,18).
PU.1 Binding (binds) of
10) Confidence 0.06 Published 2008 Journal Diabetes Care Section Body Doc Link PMC2518353 Disease Relevance 1.23 Pain Relevance 0.07
PU.1 binds to purine-rich regions of the TLR gene promoter to activate their transcription.
PU.1 Binding (binds) of
11) Confidence 0.06 Published 2008 Journal Diabetes Care Section Body Doc Link PMC2518353 Disease Relevance 0.92 Pain Relevance 0.10
PU.1 assay was performed using specific binding site oligonucleotides corresponding to the PU.1 binding sites on TLR4 promoter (18): sense CGCTTTCACTTCCTCTCACCCTT and antisense AAGGGTGAGAGGAAGTGAAAGCG.
PU.1 Binding (binding) of
12) Confidence 0.06 Published 2008 Journal Diabetes Care Section Body Doc Link PMC2518353 Disease Relevance 0 Pain Relevance 0
To deal with these problems the solution that was often recommended was to combine scores of PU risk scales with clinical judgment.1 Unfortunately, this recommendation, albeit often seen in the literature, is logically inconsistent because as Papanikolaou et al23 put it: “If PU risk assessment scales have such limitations, what contribution can they make to our confidence in clinical judgment, other than prompting us about the items, which should be considered when making such judgments?”
PU Binding (combine) of associated with decubitus ulcers
13) Confidence 0.06 Published 2010 Journal Journal of multidisciplinary healthcare Section Body Doc Link PMC3004596 Disease Relevance 0.55 Pain Relevance 0
Irrespective of study results, the main goal of PU risk scales is to predict who will develop PUs for the purpose of planning effective prevention strategies.34,63 There is the idea that the main benefit of PU risk scales lies in its acting as a reminder to nurses about possible PU development.
PU Binding (reminder) of associated with decubitus ulcers
14) Confidence 0.06 Published 2010 Journal Journal of multidisciplinary healthcare Section Body Doc Link PMC3004596 Disease Relevance 1.28 Pain Relevance 0
There is an ongoing debate about what PUs really are, how they develop, and how these lesions should be classified accurately.2–4 Even the recent international collaboration between NPUAP and EPUAP was unable to find a consensus about PU classification.1
PU Neg (unable) Binding (consensus) of associated with decubitus ulcers
15) Confidence 0.06 Published 2010 Journal Journal of multidisciplinary healthcare Section Body Doc Link PMC3004596 Disease Relevance 1.24 Pain Relevance 0.09
Nuclear PU.1 DNA binding activity was measured by an electromobility shift assay.
PU.1 Binding (activity) of
16) Confidence 0.05 Published 2008 Journal Diabetes Care Section Body Doc Link PMC2518353 Disease Relevance 0 Pain Relevance 0
These similarities strongly suggest that InvG forms the outer rings of the needle complex of the SPI-1 T3SS base.
SPI-1 T3SS base Binding (complex) of
17) Confidence 0.02 Published 2010 Journal PLoS Pathogens Section Body Doc Link PMC2848554 Disease Relevance 0.08 Pain Relevance 0

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox