INT247748

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.54
First Reported 2008
Last Reported 2008
Negated 1
Speculated 0
Reported most in Body
Documents 1
Total Number 4
Disease Relevance 0.35
Pain Relevance 0.07

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

signal transduction (Ccrl2) plasma membrane (Ccrl2) signal transducer activity (Ccrl2)
Anatomy Link Frequency
mast cell 1
Ccrl2 (Mus musculus)
Pain Link Frequency Relevance Heat
Inflammation 32 77.68 Quite High
cytokine 24 69.24 Quite High
Inflammatory response 12 13.68 Low Low
chemokine 132 5.00 Very Low Very Low Very Low
Potency 8 5.00 Very Low Very Low Very Low
ketamine 4 5.00 Very Low Very Low Very Low
anesthesia 4 5.00 Very Low Very Low Very Low
Bioavailability 4 5.00 Very Low Very Low Very Low
Multiple sclerosis 4 5.00 Very Low Very Low Very Low
agonist 4 5.00 Very Low Very Low Very Low
Disease Link Frequency Relevance Heat
Anaphylaxis 116 86.88 High High
INFLAMMATION 44 77.68 Quite High
Contact Dermatitis 28 67.12 Quite High
Edema 76 50.40 Quite High
Disease 8 47.68 Quite Low
Hypersensitivity 8 29.68 Quite Low
Demyelinating Disease 4 5.00 Very Low Very Low Very Low
Overdose 4 5.00 Very Low Very Low Very Low
Lymphatic System Cancer 4 5.00 Very Low Very Low Very Low
Cancer 4 5.00 Very Low Very Low Very Low

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
Thus, the presence of absence of CCRL2 on BMCMCs did not significantly influence the basic mast cell functions tested here.


Neg (absence) Localization (absence) of CCRL2 in mast cell
1) Confidence 0.54 Published 2008 Journal The Journal of Experimental Medicine Section Body Doc Link PMC2556791 Disease Relevance 0.35 Pain Relevance 0.07
For direct chemerin binding immunofluorescence assays, mCCRL2-HA, huCCRL2-HA, mCMKLR1-HA, and mCRTH2-HA L1.2 transfectants were incubated for 30 min on ice with 10 nM His8-tagged serum form human chemerin and the indicated concentration of untagged chemerin in binding buffer (PBS with 0.5% BSA and 0.02% azide).
Localization (transfectants) of huCCRL2-HA
2) Confidence 0.47 Published 2008 Journal The Journal of Experimental Medicine Section Body Doc Link PMC2556791 Disease Relevance 0 Pain Relevance 0
, ttccaacatcctcctccttg; mCCRL2 3?
Localization (ttccaacatcctcctccttg) of mCCRL2
3) Confidence 0.47 Published 2008 Journal The Journal of Experimental Medicine Section Body Doc Link PMC2556791 Disease Relevance 0 Pain Relevance 0
For direct chemerin binding immunofluorescence assays, mCCRL2-HA, huCCRL2-HA, mCMKLR1-HA, and mCRTH2-HA L1.2 transfectants were incubated for 30 min on ice with 10 nM His8-tagged serum form human chemerin and the indicated concentration of untagged chemerin in binding buffer (PBS with 0.5% BSA and 0.02% azide).
Localization (transfectants) of mCCRL2-HA
4) Confidence 0.47 Published 2008 Journal The Journal of Experimental Medicine Section Body Doc Link PMC2556791 Disease Relevance 0 Pain Relevance 0

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox