INT247748

Context Info Confidence 0.54 First Reported 2008 Last Reported 2008 Negated 1 Speculated 0 Reported most in Body Documents 1 Total Number 4 Disease Relevance 0.35 Pain Relevance 0.07

signal transduction (Ccrl2) plasma membrane (Ccrl2) signal transducer activity (Ccrl2)

Anatomy Link Frequency mast cell 1 Ccrl2 (Mus musculus)

Pain Link Frequency Relevance Heat Inflammation 32 77.68 cytokine 24 69.24 Inflammatory response 12 13.68 chemokine 132 5.00 Potency 8 5.00 ketamine 4 5.00 anesthesia 4 5.00 Bioavailability 4 5.00 Multiple sclerosis 4 5.00 agonist 4 5.00

Disease Link Frequency Relevance Heat Anaphylaxis 116 86.88 INFLAMMATION 44 77.68 Contact Dermatitis 28 67.12 Edema 76 50.40 Disease 8 47.68 Hypersensitivity 8 29.68 Demyelinating Disease 4 5.00 Overdose 4 5.00 Lymphatic System Cancer 4 5.00 Cancer 4 5.00

Sentences Mentioned In

Key:

Protein

Mutation

Event

Anatomy

Negation

Speculation

Pain term

Disease term

Thus, the presence of absence of CCRL2 on BMCMCs did not significantly influence the basic mast cell functions tested here.

Neg (absence) Localization (absence) of CCRL2 in mast cell

1) Confidence 0.54 Published 2008 Journal The Journal of Experimental Medicine Section Body Doc Link PMC2556791 Disease Relevance 0.35 Pain Relevance 0.07

For direct chemerin binding immunofluorescence assays, mCCRL2-HA, huCCRL2-HA, mCMKLR1-HA, and mCRTH2-HA L1.2 transfectants were incubated for 30 min on ice with 10 nM His8-tagged serum form human chemerin and the indicated concentration of untagged chemerin in binding buffer (PBS with 0.5% BSA and 0.02% azide).

Localization (transfectants) of huCCRL2-HA

2) Confidence 0.47 Published 2008 Journal The Journal of Experimental Medicine Section Body Doc Link PMC2556791 Disease Relevance 0 Pain Relevance 0

, ttccaacatcctcctccttg; mCCRL2 3?

Localization (ttccaacatcctcctccttg) of mCCRL2

3) Confidence 0.47 Published 2008 Journal The Journal of Experimental Medicine Section Body Doc Link PMC2556791 Disease Relevance 0 Pain Relevance 0

For direct chemerin binding immunofluorescence assays, mCCRL2-HA, huCCRL2-HA, mCMKLR1-HA, and mCRTH2-HA L1.2 transfectants were incubated for 30 min on ice with 10 nM His8-tagged serum form human chemerin and the indicated concentration of untagged chemerin in binding buffer (PBS with 0.5% BSA and 0.02% azide).

Localization (transfectants) of mCCRL2-HA

4) Confidence 0.47 Published 2008 Journal The Journal of Experimental Medicine Section Body Doc Link PMC2556791 Disease Relevance 0 Pain Relevance 0

General Comments

This test has worked.