INT262799
From wiki-pain
|
|
|
|
|
Sentences Mentioned In
Key: | Protein | Mutation | Event | Anatomy | Negation | Speculation | Pain term | Disease term |
Findings for the models described above, as well as the recently developed alkali burn model, are in contrast to earlier work by Saika and colleagues which showed that Smad3 deficient mice were resistant to ASC formation in response to lens injury [45]. | |||||||||||||||
| |||||||||||||||
|
Since Sox17 negatively regulated Smad3 transcriptional activity in reporter assays but did not influence Smad3 nuclear import, we sought to determine if the repression was mediated by influencing Smad3 DNA binding. | |||||||||||||||
| |||||||||||||||
|
However, none of the Sox17 proteins influenced nuclear translocation of Smad3 in the presence or absence of TGF-? | |||||||||||||||
| |||||||||||||||
|
Genes monitored were smad2, smad3, TGF-? | |||||||||||||||
| |||||||||||||||
|
Primer pairs (Invitrogen) used were smad2 (For: CGGAGATTCTAACAGAACTG; Rev: TGCTTGAGCATCGCACTGAA), smad3 (For: AGCACACAATAACTTGGACC; Rev: TAAGACACACTGGAACAGCGGATG), TGF-? | |||||||||||||||
| |||||||||||||||
|
The phosphorylated Smad2 and Smad3 then form a complex with Smad4 and translocate to the nucleus [29,30]. | |||||||||||||||
| |||||||||||||||
|
General Comments
This test has worked.