INT265662

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.37
First Reported 2009
Last Reported 2009
Negated 0
Speculated 0
Reported most in Body
Documents 4
Total Number 4
Disease Relevance 1.29
Pain Relevance 2.42

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

cytosol (COMT) mitochondrion (COMT) small molecule metabolic process (COMT)
plasma membrane (COMT) cytoplasm (COMT)
COMT (Homo sapiens)
Pain Link Frequency Relevance Heat
Catechol-O-methyltransferase 442 100.00 Very High Very High Very High
Face pain 6 99.80 Very High Very High Very High
Pain 85 98.28 Very High Very High Very High
Catecholamine 16 96.08 Very High Very High Very High
Central nervous system 15 94.92 High High
IPN 18 81.20 Quite High
Dopamine 6 36.32 Quite Low
noradrenaline 3 35.28 Quite Low
Inflammation 25 31.52 Quite Low
cytokine 22 5.00 Very Low Very Low Very Low
Disease Link Frequency Relevance Heat
Facial Pain 6 99.80 Very High Very High Very High
Pain 85 98.28 Very High Very High Very High
Hantavirus Infection 78 96.92 Very High Very High Very High
Inflammatory Pain 18 81.20 Quite High
Schizophrenia 8 78.08 Quite High
Aggression 1 77.36 Quite High
Temporomandibular Joint Disorders 5 44.68 Quite Low
Cancer 11 44.32 Quite Low
Necrosis 6 43.84 Quite Low
Hyperhomocysteinemia 2 35.20 Quite Low

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
Individuals exhibiting both the highest and lowest COMT activity were homozygous for the val158 allele, which is present in both the LPS and HPS haplotypes.
Negative_regulation (exhibiting) of COMT Binding (activity) of associated with catechol-o-methyltransferase and hantavirus infection
1) Confidence 0.37 Published 2009 Journal PLoS ONE Section Body Doc Link PMC2664927 Disease Relevance 0.54 Pain Relevance 0.18
Myofacial pain patients exhibit lower COMT activity relative to controls [7], and COMT inhibition increases pain sensitivity in rodents by promoting catecholamine stimulation of ?
Negative_regulation (lower) of COMT Binding (activity) of associated with pain, catechol-o-methyltransferase, catecholamine and face pain
2) Confidence 0.37 Published 2009 Journal Mol Pain Section Body Doc Link PMC2662804 Disease Relevance 0.38 Pain Relevance 1.05
Myofacial pain patients exhibit lower COMT activity relative to controls [7], and COMT inhibition increases pain sensitivity in rodents by promoting catecholamine stimulation of ?
Negative_regulation (exhibit) of COMT Binding (activity) of associated with pain, catechol-o-methyltransferase, catecholamine and face pain
3) Confidence 0.37 Published 2009 Journal Mol Pain Section Body Doc Link PMC2662804 Disease Relevance 0.38 Pain Relevance 1.06
Competition experiments were performed with the wild-type (ACCGCGGGGACGCCCGGGGACGCCCCGACC) and mutant (5'-ACCGCGCTCACGCCCGCTCACGCCCCGACC) oligonucleotides specific to P2-COMT ?
Negative_regulation (oligonucleotides) of P2-COMT Binding (specific) of associated with catechol-o-methyltransferase
4) Confidence 0.37 Published 2009 Journal Mol Pain Section Body Doc Link PMC2662804 Disease Relevance 0 Pain Relevance 0.13

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox