INT27077

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.37
First Reported 1989
Last Reported 2008
Negated 1
Speculated 0
Reported most in Body
Documents 4
Total Number 4
Disease Relevance 2.14
Pain Relevance 0.72

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

lipid binding (CD36) transport (CD36) small molecule metabolic process (CD36)
cell adhesion (CD36) Golgi apparatus (CD36) plasma membrane (CD36)
Anatomy Link Frequency
fat cell 1
CD36 (Homo sapiens)
Pain Link Frequency Relevance Heat
Angina 3 98.36 Very High Very High Very High
depression 3 92.60 High High
cytokine 153 92.04 High High
antagonist 4 85.24 High High
Clonidine 3 83.48 Quite High
agonist 1 65.56 Quite High
Inflammation 148 50.00 Quite Low
Inflammatory response 11 5.00 Very Low Very Low Very Low
corticosteroid 2 5.00 Very Low Very Low Very Low
addiction 2 5.00 Very Low Very Low Very Low
Disease Link Frequency Relevance Heat
Disease 97 100.00 Very High Very High Very High
Obesity 6 100.00 Very High Very High Very High
Metabolic Syndrome 3 99.76 Very High Very High Very High
Cv General 3 Under Development 2 98.36 Very High Very High Very High
Adhesions 13 98.00 Very High Very High Very High
Sprains And Strains 8 96.92 Very High Very High Very High
Angina 1 94.84 High High
Depression 2 92.60 High High
Muscular Spasm 1 88.52 High High
Pathologic Constriction 1 84.08 Quite High

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
Type I CD36 deficiency associated with metabolic syndrome and vasospastic angina: a case report.
CD36 Binding (associated) of associated with angina and metabolic syndrome
1) Confidence 0.37 Published 2006 Journal J Cardiol Section Title Doc Link 16886497 Disease Relevance 0.69 Pain Relevance 0.30
We demonstrated that [3H]RX 821002 was a more suitable radioligand than [3H]yohimbine for labelling hamster fat cell alpha 2-adrenoceptors (KD = 1.0 +/- 0.1 nM, Bmax = 776 +/- 60 fmol/mg protein).
fat Binding (radioligand) of in fat cell associated with obesity
2) Confidence 0.36 Published 1989 Journal Eur. J. Pharmacol. Section Abstract Doc Link 2575998 Disease Relevance 0.35 Pain Relevance 0.35
Genes study 1; GUCA2A: gggttgggaaactcaggaactttg, tacaggcagcgtaggcacag; PCNA: gccactccactctcttcaacgg, tggtgacagaaaagacttcagtatatgc; CD36: ggaatctgtcctattgggaaagtcactgc, ctgggttttcaactggagaggcaaagg; FOS: ctgtgtctcttttctctttctccttagtc, tccagcaccaggttaattccaataatg; DUSP1: agcagaggcgaagcatcatc, acggtggtggtggaggtg.
CD36 Binding (agcagaggcgaagcatcatc) of
3) Confidence 0.21 Published 2008 Journal BMC Genomics Section Body Doc Link PMC2519092 Disease Relevance 0 Pain Relevance 0
One study found no association between disease severity and adherence to CD36, and significance for ICAM-1 when anaemic cases are discarded [320], while another reported a significant inverse correlation of illness severity with both binding sites [321].
CD36 Neg (no) Binding (association) of associated with disease
4) Confidence 0.10 Published 2006 Journal Malar J Section Body Doc Link PMC1629020 Disease Relevance 1.10 Pain Relevance 0.07

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox