INT283195

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.01
First Reported 2009
Last Reported 2009
Negated 0
Speculated 0
Reported most in Body
Documents 1
Total Number 1
Disease Relevance 0.18
Pain Relevance 0

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

molecular_function (Gm4658) cellular_component (Gm4658) biological_process (Gm4658)
Gm4658 (Mus musculus)
Pain Link Frequency Relevance Heat
depression 1 32.24 Quite Low
beta blocker 1 5.00 Very Low Very Low Very Low
agonist 1 5.00 Very Low Very Low Very Low
fibrosis 1 5.00 Very Low Very Low Very Low
Inflammation 1 5.00 Very Low Very Low Very Low
Pain 1 5.00 Very Low Very Low Very Low
Disease Link Frequency Relevance Heat
Depression 2 59.84 Quite High
Anxiety Disorder 1 59.24 Quite High
Muscular Dystrophy 43 50.00 Quite Low
Stress 2 43.96 Quite Low
Affective Disorder 1 32.24 Quite Low
Duchenne Muscular Dystrophy 4 5.00 Very Low Very Low Very Low
Respiratory Failure 2 5.00 Very Low Very Low Very Low
Fibrosis 1 5.00 Very Low Very Low Very Low
Toxicity 1 5.00 Very Low Very Low Very Low
Coronary Heart Disease 1 5.00 Very Low Very Low Very Low

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
AVI-4658 is an exon 51-targeted PMO (sequence CTCCAACATCAAGGAAGATGGCATTTCTAG).39 AVI-4658 was synthesised and purified by AVI BioPharma (Portland, OR, USA) and was supplied as a low endotoxin and low bioburden powder, which was reconstituted in normal saline in the operating theatre.
Gene_expression (synthesised) of AVI-4658
1) Confidence 0.01 Published 2009 Journal Lancet Neurol Section Body Doc Link PMC2755039 Disease Relevance 0.18 Pain Relevance 0

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox