INT329148

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.76
First Reported 2010
Last Reported 2010
Negated 6
Speculated 0
Reported most in Body
Documents 17
Total Number 17
Disease Relevance 6.00
Pain Relevance 2.95

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

signal transduction (CNTNAP2) cell adhesion (CNTNAP2) Golgi apparatus (CNTNAP2)
enzyme binding (CNTNAP2)
Anatomy Link Frequency
hippocampus 4
cerebellum 3
sciatic nerve 1
inferior 1
CNTNAP2 (Homo sapiens)
Pain Link Frequency Relevance Heat
Hippocampus 112 99.96 Very High Very High Very High
potassium channel 1328 99.52 Very High Very High Very High
Sciatic nerve 64 98.88 Very High Very High Very High
Pyramidal cell 32 97.24 Very High Very High Very High
Neuropathic pain 32 70.08 Quite High
imagery 33 55.60 Quite High
bDMF 1 37.44 Quite Low
Pain 65 19.08 Low Low
depression 43 5.00 Very Low Very Low Very Low
hyperexcitability 32 5.00 Very Low Very Low Very Low
Disease Link Frequency Relevance Heat
Glioma 96 100.00 Very High Very High Very High
Cancer 304 99.60 Very High Very High Very High
Syndrome 704 98.60 Very High Very High Very High
Thymoma 112 98.36 Very High Very High Very High
Limbic Encephalitis 432 98.18 Very High Very High Very High
Isaacs Syndrome 400 93.04 High High
Epilepsy 256 91.52 High High
Amnesia 64 87.36 High High
Confusion 64 86.64 High High
Targeted Disruption 32 85.60 High High

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
Figure 5Expression pattern of Caspr2 and Lgi1 in the CNS.
Gene_expression (5Expression) of Caspr2
1) Confidence 0.76 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.08 Pain Relevance 0.21
Although in this cohort, only three of the five patients with Morvan’s syndrome had Caspr2-antibodies, in a further nine patients with Morvan’s syndrome and VGKC-antibodies, the majority had Caspr2-antibodies and six had thymomas (Vincent, 2009 and unpublished observations); it will be interesting to look for Caspr2 expression in these tumours.
Gene_expression (expression) of Caspr2 associated with cancer, syndrome, thymoma and potassium channel
2) Confidence 0.76 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 1.30 Pain Relevance 0.26
By contrast, Caspr2 was expressed more prominently in the stratum radiatum of CA3 (Fig. 5A and B) and molecular and granule cell layers of the cerebellum (Fig. 5C and D), but not in the mossy fibre layer of CA3 or in the cerebellar pinceau.
Neg (not) Gene_expression (expressed) of Caspr2 in cerebellum
3) Confidence 0.76 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.09 Pain Relevance 0.23
The fragment was subcloned into pcDNA3.1 (+) (Invitrogen) to give an untagged Caspr2 that expressed in mammalian cells.
Gene_expression (expressed) of Caspr2
4) Confidence 0.76 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0 Pain Relevance 0.05
In the cerebellum, Caspr2 (C and D) is expressed in the molecular (mol) and granule cell layers (GCL), but not in the pinceau (green arrows) where Kv1.1 (C) as well as Lgi1 (D) are strongly expressed.
Neg (not) Gene_expression (expressed) of Caspr2 in cerebellum
5) Confidence 0.66 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.12 Pain Relevance 0.19
In the CA3 area of the hippocampus, Caspr2 (A and B) is strongly expressed in the stratum radiatum (rad), whereas Kv1.1 (A) and Lgi1 (B) are most prominent in the mossy fibre layer (mf) where Caspr2 is almost absent.
Gene_expression (expressed) of Caspr2 in hippocampus associated with hippocampus
6) Confidence 0.66 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.12 Pain Relevance 0.24
Conversely, it is highly likely that some patients with limbic encephalitis or Morvan’s syndrome, previously negative for VGKC antibodies, will prove to have Lgi1 or Caspr2 antibodies.
Gene_expression (antibodies) of Caspr2 associated with syndrome, limbic encephalitis and potassium channel
7) Confidence 0.66 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.53 Pain Relevance 0.16
-dendrotoxin-labelled potassium channels in brain extracts: (i) contactin-associated protein-2 that is localized at the juxtaparanodes in myelinated axons; (ii) leucine-rich, glioma inactivated 1 protein that is most strongly expressed in the hippocampus; and (iii) Tag-1/contactin-2 that associates with contactin-associated protein-2.
Gene_expression (expressed) of contactin-associated protein-2 in hippocampus associated with hippocampus, potassium channel and glioma
8) Confidence 0.66 Published 2010 Journal Brain Section Abstract Doc Link PMC2929337 Disease Relevance 1.25 Pain Relevance 0.41
Clinical significance of Lgi1 and Caspr2 antibodies
Gene_expression (antibodies) of Caspr2
9) Confidence 0.66 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.87 Pain Relevance 0.11
To express Lgi1 fused to the transmembrane region of Caspr2, the C-terminal cDNA sequence of Caspr2 (residues 1248–1331) was amplified by polymerase chain reaction with the primers GATCCTCGAGGGACAAGGCCAAGCTATAAGAAATG and ATCGTTTAAACTCAAATGAGCCATTCCTTTTTGC.
Gene_expression (express) of Caspr2
10) Confidence 0.66 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0 Pain Relevance 0
In E–G staining of sciatic nerve teased fibres with antibodies to the paranodal marker Caspr (distinct from Caspr2) and patient serum, shows that Caspr2-reactive Serum 6 strongly labels the juxtaparanodes that are known to express Caspr2 but not significantly Lgi1 (green arrows in E), whereas Lgi1-reactive Serum 1 (F), as well as a control serum (G), shows no specific binding.
Neg (not) Gene_expression (express) of Caspr2 in sciatic nerve associated with sciatic nerve
11) Confidence 0.59 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.36 Pain Relevance 0.12
In the CA3 area of the hippocampus Serum 6 (A) binds strongly to the stratum radiatum (rad) where Caspr2 is prominently expressed (A) but not to the mossy fibre layer (mf) where Caspr2 is almost absent.
Neg (not) Gene_expression (expressed) of Caspr2 in hippocampus associated with hippocampus
12) Confidence 0.59 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.38 Pain Relevance 0.15
In order to tag Caspr2 with enhanced green fluorescent protein (EGFP), the pcDNA3.1 (+)-Caspr2 plasmid was digested with XhoI and XmaI.
Gene_expression (tag) of Caspr2
13) Confidence 0.58 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0 Pain Relevance 0.05
In order to detect antibodies to Caspr2, we expressed full-length human Caspr2 in HEK293 cells, tagging the protein by introducing EGFP at the intracellular C-terminus.
Gene_expression (expressed) of Caspr2
14) Confidence 0.58 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0 Pain Relevance 0.17
Six sera (all Lgi1-antibody positive) bound with similar localization to that of antibodies to Lgi1, whereas two (both Caspr2-antibody positive) showed strong binding that was similar to that of antibodies to Caspr2 in both the hippocampus and cerebellum, as well as at the juxtaparanodes of teased sciatic nerve fibres (Fig. 6 and data not shown), which are known to express strongly Caspr2 (Poliak et al., 1999) but not significantly Lgi1 (data not shown).
Neg (not) Gene_expression (express) of Caspr2 in cerebellum associated with sciatic nerve and hippocampus
15) Confidence 0.51 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.17 Pain Relevance 0.31
CNTNAP2 is differentially expressed during human ontogenesis in the middle and inferior frontal gyri (Abrahams et al., 2007).
Gene_expression (expressed) of CNTNAP2 in inferior
16) Confidence 0.41 Published 2010 Journal Frontiers in Human Neuroscience Section Body Doc Link PMC2987679 Disease Relevance 0.57 Pain Relevance 0
Six sera (all Lgi1-antibody positive) bound with similar localization to that of antibodies to Lgi1, whereas two (both Caspr2-antibody positive) showed strong binding that was similar to that of antibodies to Caspr2 in both the hippocampus and cerebellum, as well as at the juxtaparanodes of teased sciatic nerve fibres (Fig. 6 and data not shown), which are known to express strongly Caspr2 (Poliak et al., 1999) but not significantly Lgi1 (data not shown).
Neg (not) Gene_expression (express) of Caspr2 in hippocampus associated with sciatic nerve and hippocampus
17) Confidence 0.18 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.17 Pain Relevance 0.31

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox