
From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.49
First Reported 2010
Last Reported 2010
Negated 0
Speculated 0
Reported most in Body
Documents 1
Total Number 2
Disease Relevance 0.54
Pain Relevance 0.15

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

signal transduction (CNTNAP2) cell adhesion (CNTNAP2) Golgi apparatus (CNTNAP2)
enzyme binding (CNTNAP2)
CNTNAP2 (Homo sapiens)
Pain Link Frequency Relevance Heat
potassium channel 166 96.32 Very High Very High Very High
Hippocampus 14 5.00 Very Low Very Low Very Low
Pain 8 5.00 Very Low Very Low Very Low
Sciatic nerve 8 5.00 Very Low Very Low Very Low
hyperexcitability 4 5.00 Very Low Very Low Very Low
Neuropathic pain 4 5.00 Very Low Very Low Very Low
Pyramidal cell 4 5.00 Very Low Very Low Very Low
imagery 4 5.00 Very Low Very Low Very Low
Central nervous system 2 5.00 Very Low Very Low Very Low
Inflammation 2 5.00 Very Low Very Low Very Low
Disease Link Frequency Relevance Heat
Glioma 12 100.00 Very High Very High Very High
Syndrome 88 94.12 High High
Cancer 38 91.56 High High
Limbic Encephalitis 54 79.16 Quite High
Isaacs Syndrome 50 61.24 Quite High
Epilepsy 32 34.72 Quite Low
Thymoma 14 30.16 Quite Low
Dystonia 2 13.24 Low Low
Sleep Disorders 16 5.00 Very Low Very Low Very Low
Convulsion 8 5.00 Very Low Very Low Very Low

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
Surprisingly, only a few patients had antibodies binding to the Kv1 subunits themselves but most bound only to one of two proteins, leucine-rich glioma inactivated 1 (Lgi1) or contactin-associated protein-2 (Caspr2), that are part of the ?
Positive_regulation (glioma) of contactin-associated protein-2 associated with glioma
1) Confidence 0.49 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0.54 Pain Relevance 0.15
To express Lgi1 fused to the transmembrane region of Caspr2, the C-terminal cDNA sequence of Caspr2 (residues 1248–1331) was amplified by polymerase chain reaction with the primers GATCCTCGAGGGACAAGGCCAAGCTATAAGAAATG and ATCGTTTAAACTCAAATGAGCCATTCCTTTTTGC.
Positive_regulation (amplified) of Caspr2
2) Confidence 0.46 Published 2010 Journal Brain Section Body Doc Link PMC2929337 Disease Relevance 0 Pain Relevance 0

General Comments

This test has worked.

Personal tools
