INT336620

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.57
First Reported 2010
Last Reported 2010
Negated 0
Speculated 0
Reported most in Body
Documents 1
Total Number 7
Disease Relevance 4.97
Pain Relevance 0.13

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

extracellular space (Fbln1) extracellular region (Fbln1) proteinaceous extracellular matrix (Fbln1)
extracellular matrix organization (Fbln1)
Fbln1 (Mus musculus)
Pain Link Frequency Relevance Heat
anesthesia 7 71.56 Quite High
cytokine 7 69.08 Quite High
ketamine 7 51.76 Quite High
corticosteroid 28 42.36 Quite Low
imagery 7 34.44 Quite Low
Inflammation 21 26.08 Quite Low
fibrosis 7 5.00 Very Low Very Low Very Low
Thoracotomy 7 5.00 Very Low Very Low Very Low
Immobilon 7 5.00 Very Low Very Low Very Low
Disease Link Frequency Relevance Heat
Asthma 665 99.84 Very High Very High Very High
Occupational Lung Diseases 98 98.88 Very High Very High Very High
Injury 245 92.32 High High
Wound Healing 35 85.20 High High
Cancer 7 66.88 Quite High
Airway Remodeling 56 50.04 Quite High
Stroke 14 38.48 Quite Low
INFLAMMATION 21 26.08 Quite Low
Disease 14 16.88 Low Low
Lung Injury 7 15.68 Low Low

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
To produce ECM with suppressed FBLN-1C expression, ASM cells were seeded in 75 cm2 flasks and transfected as described above.
Negative_regulation (suppressed) of Gene_expression (expression) of FBLN-1C
1) Confidence 0.57 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0 Pain Relevance 0
decreased FBLN-1D mRNA expression (figure 2D) was consistent with the findings of Laprise et al., who reported reduced FBLN-1D mRNA expression in lysates from asthma derived bronchial biopsies compared with those derived from non-asthmatics [15].
Negative_regulation (reduced) of Gene_expression (expression) of FBLN-1D mRNA associated with asthma and occupational lung diseases
2) Confidence 0.57 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 1.02 Pain Relevance 0
In addition, Laprise et al., reported reduced FBLN-1D expression in asthma derived bronchial biopsies compared with those derived from non-asthmatics [15].
Negative_regulation (reduced) of Gene_expression (expression) of FBLN-1D associated with asthma and occupational lung diseases
3) Confidence 0.57 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0.61 Pain Relevance 0.03
decreased FBLN-1D mRNA expression (figure 2D) was consistent with the findings of Laprise et al., who reported reduced FBLN-1D mRNA expression in lysates from asthma derived bronchial biopsies compared with those derived from non-asthmatics [15].
Negative_regulation (decreased) of Gene_expression (expression) of FBLN-1D mRNA associated with asthma and occupational lung diseases
4) Confidence 0.57 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0.92 Pain Relevance 0
FBLN-1C expression in the ECM was suppressed by AO treatment and ASM cells were reseeded on the ECM as previously described [6].
Negative_regulation (suppressed) of Gene_expression (expression) of FBLN-1C
5) Confidence 0.57 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0.93 Pain Relevance 0
ASM cell derived soluble FBLN-1 levels from the two patient groups were not different, either basally or after stimulation with TGF?
Negative_regulation (derived) of Gene_expression (levels) of FBLN-1
6) Confidence 0.41 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 1.48 Pain Relevance 0
UUUUCUCUUGGCGGAAGCUGCAGA) were used in equal parts to silence the expression of FBLN-1 in the mice, and a scrambled AO (5?
Negative_regulation (silence) of Gene_expression (expression) of FBLN-1
7) Confidence 0.41 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0 Pain Relevance 0.10

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox