INT336624

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.57
First Reported 2010
Last Reported 2010
Negated 0
Speculated 0
Reported most in Body
Documents 1
Total Number 13
Disease Relevance 8.49
Pain Relevance 0.19

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

extracellular space (Fbln1) extracellular region (Fbln1) proteinaceous extracellular matrix (Fbln1)
extracellular matrix organization (Fbln1)
Anatomy Link Frequency
lung 1
Fbln1 (Mus musculus)
Pain Link Frequency Relevance Heat
imagery 13 92.56 High High
cytokine 13 82.24 Quite High
corticosteroid 52 78.36 Quite High
Inflammation 39 39.24 Quite Low
Immobilon 13 32.20 Quite Low
ketamine 13 5.00 Very Low Very Low Very Low
fibrosis 13 5.00 Very Low Very Low Very Low
anesthesia 13 5.00 Very Low Very Low Very Low
Thoracotomy 13 5.00 Very Low Very Low Very Low
Disease Link Frequency Relevance Heat
Injury 455 99.40 Very High Very High Very High
Asthma 1235 99.32 Very High Very High Very High
Wound Healing 65 96.52 Very High Very High Very High
Occupational Lung Diseases 182 92.60 High High
Breast Cancer 26 85.20 High High
Fibrosarcoma 13 83.28 Quite High
Airway Remodeling 104 75.00 Quite High
Disease 26 52.88 Quite High
Cancer 13 40.56 Quite Low
INFLAMMATION 39 39.24 Quite Low

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
Fibulin-1C downregulation by transcript specific targeted antisense oligmer
Negative_regulation (downregulation) of Fibulin-1C
1) Confidence 0.57 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0 Pain Relevance 0.05
ECM in which FBLN-1C was suppressed was produced using the FBLN-1C AO and prepared as described above.
Negative_regulation (suppressed) of FBLN-1C
2) Confidence 0.50 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0.66 Pain Relevance 0
We did not observe any additive effect on wound repair or proliferation when FBLN-1C in both ASM and ECM was downregulated (data not shown), which suggests that decreasing FBLN-1C in either component is adequate to inhibit these cellular processes.
Negative_regulation (decreasing) of FBLN-1C associated with injury
3) Confidence 0.50 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0.92 Pain Relevance 0
We did not observe any additive effect on wound repair or proliferation when FBLN-1C in both ASM and ECM was downregulated (data not shown), which suggests that decreasing FBLN-1C in either component is adequate to inhibit these cellular processes.
Negative_regulation (downregulated) of FBLN-1C associated with injury
4) Confidence 0.50 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0.95 Pain Relevance 0
increased FBLN-1 deposition in the ECM from asthmatic ASM cells (P<0.01, figure 4B).
Negative_regulation (deposition) of FBLN-1 associated with asthma
5) Confidence 0.42 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 1.31 Pain Relevance 0.03
ASM cells were seeded in 24 well plates in the presence or absence of the FBLN-1C AO.
Negative_regulation (absence) of FBLN-1C AO
6) Confidence 0.42 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0.24 Pain Relevance 0
These features were reversed when fibulin-1C was suppressed using an antisense oligomer.
Negative_regulation (suppressed) of fibulin-1C
7) Confidence 0.42 Published 2010 Journal PLoS ONE Section Abstract Doc Link PMC2954173 Disease Relevance 0.57 Pain Relevance 0
The increased FBLN-1 resulted in exaggerated proliferation and wound repair in asthma derived ASM cells which was reduced when only the FBLN-1C isoform was downregulated.
Negative_regulation (downregulated) of FBLN-1C associated with asthma and injury
8) Confidence 0.42 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0.75 Pain Relevance 0
induced FBLN-1C mRNA in the ASM cells derived from asthmatic volunteers (P<0.001) but did not increase the level of FBLN-1D mRNA, rather it decreased it (p<0.001, figure 2 C & D).
Negative_regulation (decreased) of FBLN-1D mRNA associated with asthma
9) Confidence 0.42 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 1.24 Pain Relevance 0.04
However the FBLN-1C AO almost completely abolished the TGF?
Negative_regulation (abolished) of FBLN-1C AO
10) Confidence 0.41 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 1.19 Pain Relevance 0
CUUGCUAAGACUUUAUUAACGCC) was used to downregulate FBLN-1C mRNA and protein, and a scrambled AO (5?
Negative_regulation (downregulate) of FBLN-1C mRNA
11) Confidence 0.41 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0 Pain Relevance 0.04
The deposition of FBLN-1 in the ECM was assessed using an ECM ELISA according to methods described previously [29].
Negative_regulation (deposition) of FBLN-1
12) Confidence 0.41 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0.09 Pain Relevance 0
Mice deficient in FN and FBLN-1 die perinatally due to abnormal lung development [14].
Negative_regulation (deficient) of FBLN-1 in lung
13) Confidence 0.41 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0.57 Pain Relevance 0.04

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox