INT49996

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.03
First Reported 1995
Last Reported 2010
Negated 0
Speculated 0
Reported most in Body
Documents 2
Total Number 2
Disease Relevance 0.64
Pain Relevance 0.09

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

cell proliferation (PRDX1) mitochondrion (PRDX1) oxidoreductase activity (PRDX1)
nucleus (PRDX1) cytoplasm (PRDX1)
PRDX1 (Homo sapiens)
Pain Link Frequency Relevance Heat
Pain 2 59.52 Quite High
endometriosis 1 51.36 Quite High
Central grey 2 50.00 Quite Low
Morphine 2 50.00 Quite Low
Hyperesthesia 1 5.00 Very Low Very Low Very Low
Disease Link Frequency Relevance Heat
Anaplasmosis 26 92.92 High High
Congenital Anomalies 5 85.24 High High
Hyperglycemia 3 81.36 Quite High
Lymphopenia 2 78.00 Quite High
Urological Neuroanatomy 3 67.96 Quite High
Respiratory Sounds 1 58.80 Quite High
Fever 6 56.60 Quite High
Endometriosis (extended) 1 51.36 Quite High
Infection 17 50.00 Quite Low
Tick Infestations 1 29.84 Quite Low

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
The sample was tested by a modified real-time PCR [14] targeting the msp2 gene of A. phagocytophilum (primers msp25 [5'TTATGATTAGGCCTTTGGGCATG -3'] and msp23 [5'-TCAGAAAGATACACGTGCGCCC-3'] [15]).
Regulation (targeting) of msp23
1) Confidence 0.03 Published 2010 Journal Acta Vet Scand Section Body Doc Link PMC2996389 Disease Relevance 0.50 Pain Relevance 0.09
CONCLUSION: Morphine affected immunofunctions through opioid receptors in PAG, and the influences on various immunocompetent cells were different.


Regulation (affected) of PAG
2) Confidence 0.02 Published 1995 Journal Zhongguo Yao Li Xue Bao Section Body Doc Link 7597910 Disease Relevance 0.14 Pain Relevance 0

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox