INT55907

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.47
First Reported 1994
Last Reported 2010
Negated 0
Speculated 1
Reported most in Body
Documents 13
Total Number 14
Disease Relevance 5.79
Pain Relevance 3.75

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

cell differentiation (Ngfr) signal transduction (Ngfr) nuclear envelope (Ngfr)
Golgi apparatus (Ngfr) plasma membrane (Ngfr) nucleus (Ngfr)
Anatomy Link Frequency
cholinergic neurons 2
nerve 2
lower urinary tract 1
urinary bladder 1
neurons 1
Ngfr (Rattus norvegicus)
Pain Link Frequency Relevance Heat
Nerve growth factor 211 100.00 Very High Very High Very High
IPN 7 98.32 Very High Very High Very High
Hyperalgesia 1 96.92 Very High Very High Very High
Peripheral nerve injury 2 94.96 High High
dorsal root ganglion 11 91.12 High High
interstitial cystitis 12 89.84 High High
Pain 12 87.68 High High
Inflammation 19 84.40 Quite High
anesthesia 5 83.08 Quite High
Spinal cord 133 80.72 Quite High
Disease Link Frequency Relevance Heat
Inflammatory Pain 2 98.32 Very High Very High Very High
Death 47 98.12 Very High Very High Very High
Obesity 4 97.88 Very High Very High Very High
Overactive Bladder 46 97.44 Very High Very High Very High
Hyperalgesia 1 96.92 Very High Very High Very High
Injury 53 96.56 Very High Very High Very High
Apoptosis 76 96.52 Very High Very High Very High
Disease 35 96.16 Very High Very High Very High
Metabolic Syndrome 4 95.88 Very High Very High Very High
Nervous System Injury 4 94.52 High High

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
Results show that p75 is up-regulated in inflamed tissues, suggesting that p75 may bind to and take up nerve growth factor (NGF), thus participating in NGF-induced hyperalgesia.
p75 Binding (bind) of in nerve associated with hyperalgesia and nerve growth factor
1) Confidence 0.47 Published 1996 Journal Neuroreport Section Abstract Doc Link 8817519 Disease Relevance 0.41 Pain Relevance 0.40
BACKGROUND: Recent studies have revealed that the low-affinity nerve growth factor receptor, p75 neurotrophin receptor (p75NTR), is important in inflammatory pain.
nerve growth factor receptor Binding (affinity) of in nerve associated with nerve growth factor and ipn
2) Confidence 0.37 Published 2010 Journal J Orthop Sci Section Abstract Doc Link 20559810 Disease Relevance 0.35 Pain Relevance 0.52
In this study we examined the developmental course of expression of the low-affinity neurotrophin receptor (LANR), a receptor that binds to all members of the neurotrophin family, in the IPN.
low-affinity neurotrophin receptor Spec (examined) Binding (binds) of in IPN associated with ipn
3) Confidence 0.35 Published 1994 Journal Exp. Neurol. Section Abstract Doc Link 8033962 Disease Relevance 0 Pain Relevance 0.42
Septal cholinergic neurons express two different types of receptors for NGF: the tyrosine kinase receptor TrkA (TrkA), which specifically binds NGF; and the p75 neurotrophin receptor (p75), which binds all neurotrophins.
p75 Binding (binds) of in cholinergic neurons associated with nerve growth factor
4) Confidence 0.35 Published 2010 Journal Mol Neurodegener Section Body Doc Link PMC2826326 Disease Relevance 0.41 Pain Relevance 0.41
Septal cholinergic neurons express two different types of receptors for NGF: the tyrosine kinase receptor TrkA (TrkA), which specifically binds NGF; and the p75 neurotrophin receptor (p75), which binds all neurotrophins.
p75 Binding (binds) of in cholinergic neurons associated with nerve growth factor
5) Confidence 0.35 Published 2010 Journal Mol Neurodegener Section Body Doc Link PMC2826326 Disease Relevance 0.41 Pain Relevance 0.40
Primer/probe sequences are as follows: p75NTR biotinylated forward: 5'CGTGTT CTCCTGCCAGGACA3'; p75NTR reverse: 5'GAGATGCCACTGTCGCTGTG3'; p75NTR digoxygenin-labeled probe: 5'ACAGCAGCCAAGATGGAGCAATAGACAGG3'; GAPDH biotinylated forward: 5'CACCACCATGGAGAAGGCC3'; GAPDH reverse: 5'GATGGATGCCTTGGCCAGG3'; GAPDH digoxygenin-labeled probe: 5'ACAATCTTGAGTGAGTTGTCATATTTCTCG3'.
p75NTR Binding (digoxygenin) of
6) Confidence 0.33 Published 2005 Journal Reprod Biol Endocrinol Section Body Doc Link PMC1175857 Disease Relevance 0 Pain Relevance 0
Alterations of nerve-growth factor and p75(NTR) expressions in urinary bladder of fructose-fed obese rats.
p75 Binding (Alterations) of in urinary bladder associated with obesity
7) Confidence 0.30 Published 2008 Journal Neurosci. Lett. Section Title Doc Link 18585860 Disease Relevance 0.35 Pain Relevance 0.08
Primer/probe sequences are as follows: p75NTR biotinylated forward: 5'CGTGTT CTCCTGCCAGGACA3'; p75NTR reverse: 5'GAGATGCCACTGTCGCTGTG3'; p75NTR digoxygenin-labeled probe: 5'ACAGCAGCCAAGATGGAGCAATAGACAGG3'; GAPDH biotinylated forward: 5'CACCACCATGGAGAAGGCC3'; GAPDH reverse: 5'GATGGATGCCTTGGCCAGG3'; GAPDH digoxygenin-labeled probe: 5'ACAATCTTGAGTGAGTTGTCATATTTCTCG3'.
p75NTR Binding (biotinylated) of
8) Confidence 0.29 Published 2005 Journal Reprod Biol Endocrinol Section Body Doc Link PMC1175857 Disease Relevance 0 Pain Relevance 0
Neurotrophins, through interactions with Trk and/or p75NTR receptors, may contribute to neurochemical [13,14], electrophysiological [8] and organizational [4,15] plasticity of lower urinary tract (LUT) pathways after cystitis.
p75NTR Binding (interactions) of in lower urinary tract associated with cystitis
9) Confidence 0.22 Published 2007 Journal BMC Physiol Section Body Doc Link PMC2000875 Disease Relevance 0.94 Pain Relevance 0.82
Rho directly binds p75NTR and this interaction modulates Rho activity [31,32].
p75NTR Binding (binds) of
10) Confidence 0.14 Published 2009 Journal Mol Brain Section Body Doc Link PMC2789715 Disease Relevance 1.20 Pain Relevance 0.31
For instance, when sympathetic neurons, expressing p75 and TrkA surface receptors, were presented with the neurotrophic molecule BDNF, subsequent binding of BDNF to the p75NTR without binding to TrkB ultimately led to the death of the neurons via p75NTR induced apoptosis [76,77].
p75NTR Binding (binding) of in sympathetic associated with apoptosis and death
11) Confidence 0.12 Published 2010 Journal BMC Neurosci Section Body Doc Link PMC3001741 Disease Relevance 0.32 Pain Relevance 0.11
To demonstrate this strategy, Barati et al. (52) conjugated an antibody that binds to the p75NTR neurotrophin receptor (MC192) to PLL-based polyplexes and demonstrated transgene expression in targeted neurons in models of peripheral nerve injury.
p75NTR Binding (binds) of in neurons associated with nervous system injury and peripheral nerve injury
12) Confidence 0.10 Published 2007 Journal Pharm Res Section Body Doc Link PMC2292496 Disease Relevance 0.50 Pain Relevance 0.12
As for unprocessed hproNGF, the binding of the R100 variants to p75NTR receptor shows only a limited impairment, showing that the impact of the R100 mutation on p75NTR receptor binding is greater in the context of mature, processed hNGF.
p75NTR receptor Binding (binding) of
13) Confidence 0.01 Published 2010 Journal Biochem. Biophys. Res. Commun. Section Abstract Doc Link 19945432 Disease Relevance 0.43 Pain Relevance 0.07
As for unprocessed hproNGF, the binding of the R100 variants to p75NTR receptor shows only a limited impairment, showing that the impact of the R100 mutation on p75NTR receptor binding is greater in the context of mature, processed hNGF.
p75NTR receptor Binding (binding) of
14) Confidence 0.01 Published 2010 Journal Biochem. Biophys. Res. Commun. Section Abstract Doc Link 19945432 Disease Relevance 0.46 Pain Relevance 0.08

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox