INT64712

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.78
First Reported 1996
Last Reported 2010
Negated 1
Speculated 0
Reported most in Body
Documents 4
Total Number 4
Disease Relevance 1.19
Pain Relevance 1.91

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

cell differentiation (Ngfr) signal transduction (Ngfr) nuclear envelope (Ngfr)
Golgi apparatus (Ngfr) plasma membrane (Ngfr) nucleus (Ngfr)
Anatomy Link Frequency
neuronal 1
DRG 1
Schwann cells 1
Ngfr (Rattus norvegicus)
Pain Link Frequency Relevance Heat
Nerve growth factor 71 100.00 Very High Very High Very High
mu opioid receptor 8 100.00 Very High Very High Very High
Opioid 5 99.36 Very High Very High Very High
Inflammation 6 98.24 Very High Very High Very High
Pain 6 97.72 Very High Very High Very High
antinociception 3 88.88 High High
IPN 3 82.88 Quite High
Hyperalgesia 1 80.16 Quite High
GABAergic 3 67.12 Quite High
narcan 1 56.80 Quite High
Disease Link Frequency Relevance Heat
INFLAMMATION 5 98.24 Very High Very High Very High
Cystitis 1 89.28 High High
Pain 2 87.48 High High
Death 12 85.20 High High
Inflammatory Pain 3 82.88 Quite High
Targeted Disruption 4 76.80 Quite High
Apoptosis 11 71.52 Quite High
Polycystic Ovary Syndrome 87 5.00 Very Low Very Low Very Low
Disease 8 5.00 Very Low Very Low Very Low
Neurodegenerative Disease 7 5.00 Very Low Very Low Very Low

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
Electron microscopy revealed that p75 immunoreactivity was localized on the surface of Schwann cells and at the sites where they were apposed to axons.
Localization (localized) of p75 in Schwann cells
1) Confidence 0.78 Published 1996 Journal Neuroreport Section Abstract Doc Link 8817519 Disease Relevance 0.33 Pain Relevance 0.37
Primer/probe sequences are as follows: p75NTR biotinylated forward: 5'CGTGTT CTCCTGCCAGGACA3'; p75NTR reverse: 5'GAGATGCCACTGTCGCTGTG3'; p75NTR digoxygenin-labeled probe: 5'ACAGCAGCCAAGATGGAGCAATAGACAGG3'; GAPDH biotinylated forward: 5'CACCACCATGGAGAAGGCC3'; GAPDH reverse: 5'GATGGATGCCTTGGCCAGG3'; GAPDH digoxygenin-labeled probe: 5'ACAATCTTGAGTGAGTTGTCATATTTCTCG3'.
Localization (reverse) of p75NTR
2) Confidence 0.58 Published 2005 Journal Reprod Biol Endocrinol Section Body Doc Link PMC1175857 Disease Relevance 0 Pain Relevance 0
Although there were positive reactions for cleaved caspase-3 or p53 in the septal nucleus after axotomy, they did not co-localize with ChAT, p75 or the general neuronal marker NeuN (Figure 4A, B, C).
Neg (not) Localization (localize) of p75 in neuronal
3) Confidence 0.54 Published 2010 Journal Mol Neurodegener Section Body Doc Link PMC2826326 Disease Relevance 0.50 Pain Relevance 0.09
We identified co-localization of MOR with calcitonin gene-related peptides (CGRP) and with the NGF receptors tyrosine receptor kinase (TrkA) and p75(NTR) within rat dorsal root ganglia (DRG).
Localization (co-localization) of p75 in DRG associated with nerve growth factor and mu opioid receptor
4) Confidence 0.51 Published 2007 Journal Brain Section Abstract Doc Link 17142830 Disease Relevance 0.35 Pain Relevance 1.45

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox