INT85767

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.76
First Reported 2000
Last Reported 2010
Negated 1
Speculated 0
Reported most in Body
Documents 11
Total Number 17
Disease Relevance 9.27
Pain Relevance 2.74

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

transport (Scn9a) transmembrane transport (Scn9a)
Anatomy Link Frequency
brain 1
ACN 1
peripheral nervous system 1
dorsal root ganglion 1
Scn9a (Mus musculus)
Scn9a - N641Y (1)
Pain Link Frequency Relevance Heat
sodium channel 157 100.00 Very High Very High Very High
tetrodotoxin 2 100.00 Very High Very High Very High
potassium channel 21 99.92 Very High Very High Very High
dorsal root ganglion 7 99.68 Very High Very High Very High
Nav1.7 419 96.84 Very High Very High Very High
Peripheral nervous system 9 96.32 Very High Very High Very High
anticonvulsant 27 90.40 High High
Pain 389 87.56 High High
Paroxysmal extreme pain disorder 63 84.44 Quite High
primary erythermalgia 45 82.68 Quite High
Disease Link Frequency Relevance Heat
Syndrome 414 99.80 Very High Very High Very High
Febrile Convulsions 561 99.70 Very High Very High Very High
Disease 142 99.20 Very High Very High Very High
Ganglion Cysts 14 99.20 Very High Very High Very High
Convulsion 655 98.04 Very High Very High Very High
Partial Seizures 63 93.28 High High
Epilepsy 198 93.08 High High
Status Epilepticus 18 91.72 High High
Pain 403 87.56 High High
Channelopathies 37 86.04 High High

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
SCN9A, which also resides within the K4425 critical genetic interval [14], is expressed primarily in neurons of the dorsal root ganglia and has preliminarily been classified as a peripheral nervous system channel [15].
Gene_expression (expressed) of SCN9A in peripheral nervous system associated with peripheral nervous system
1) Confidence 0.76 Published 2009 Journal PLoS Genetics Section Body Doc Link PMC2730533 Disease Relevance 0.77 Pain Relevance 0.47
The GEO (GDS423 and GDS1085, for example) and Unigene (Hs.439145) databases also contain experimental evidence that SCN9A is expressed in brain.
Gene_expression (expressed) of SCN9A in brain
2) Confidence 0.76 Published 2009 Journal PLoS Genetics Section Body Doc Link PMC2730533 Disease Relevance 1.02 Pain Relevance 0.55
SCN9A is predominantly expressed in the dorsal root ganglion (DRG) neurons and sympathetic ganglion neurons [Rush et al., 2006].
Gene_expression (expressed) of SCN9A in dorsal root ganglion associated with ganglion cysts and dorsal root ganglion
3) Confidence 0.71 Published 2010 Journal Human Mutation Section Body Doc Link PMC2966863 Disease Relevance 1.32 Pain Relevance 1.01
Sequencing of SCN9A yielded a p.L1123F missense variant found only once in 1736 ethnically matched population control chromosomes (Fisher's exact p-value?
Gene_expression (Sequencing) of SCN9A
4) Confidence 0.66 Published 2009 Journal PLoS Genetics Section Body Doc Link PMC2730533 Disease Relevance 1.32 Pain Relevance 0.06
Evaluation of Electrical Thresholds and Corneal Kindling Acquisition Rates in Scn9a+/+, Scn9a+/N641Y, and Scn9aN641Y/N641Y Littermate Mice
Gene_expression (/) of Scn9a
5) Confidence 0.66 Published 2009 Journal PLoS Genetics Section Body Doc Link PMC2730533 Disease Relevance 0.24 Pain Relevance 0
The multifactorial etiology of Dravet syndrome proposed by many investigators suggests that it is very likely that genes responsible for Dravet syndrome will far outnumber SCN1A and SCN9A.
Gene_expression (outnumber) of SCN9A associated with syndrome
6) Confidence 0.66 Published 2009 Journal PLoS Genetics Section Body Doc Link PMC2730533 Disease Relevance 1.41 Pain Relevance 0.05
Briefly, the following changes were introduced into the wild-type Scn9a (Figure 2A): the p.N641Y mutation into exon 11, the ACN positive selection vector into intron 10, and the negative TK selection vector into intron 12 (Figure 2B).
Neg (negative) Gene_expression (introduced) of Scn9a in ACN
7) Confidence 0.58 Published 2009 Journal PLoS Genetics Section Body Doc Link PMC2730533 Disease Relevance 0.67 Pain Relevance 0.03
To rule out the role of SCN1A in FS susceptibility in these 5 FS patients with SCN9A variants, we sequenced the entire coding and splice site regions of SCN1A and did not find any potential disease-causing amino acid variations.


Gene_expression (variants) of SCN9A associated with febrile convulsions and disease
8) Confidence 0.58 Published 2009 Journal PLoS Genetics Section Body Doc Link PMC2730533 Disease Relevance 1.40 Pain Relevance 0.15
In an analysis of a cohort of 109 Dravet syndrome patients, 50% of whom had SCN1A mutations, we found 8 additional SCN9A variants within the transmembrane domains and intracellular and extracellular loops of Nav1.7 in 9 patients (Table 1).
Gene_expression (variants) of SCN9A associated with syndrome and nav1.7
9) Confidence 0.58 Published 2009 Journal PLoS Genetics Section Body Doc Link PMC2730533 Disease Relevance 0.85 Pain Relevance 0.10
The PCR product confirming correct splicing was amplified using primers SCN9A-2310f: CCACCCAATGACTGAGGAAT and SCN9A-2977r: GGTTGTTTGCATCAGGGTCT, PCR conditions were: 45 cycles of 95° 1?
Gene_expression (2310f) of SCN9A
10) Confidence 0.54 Published 2010 Journal Human Mutation Section Body Doc Link PMC2966863 Disease Relevance 0 Pain Relevance 0
The PCR product confirming correct splicing was amplified using primers SCN9A-2310f: CCACCCAATGACTGAGGAAT and SCN9A-2977r: GGTTGTTTGCATCAGGGTCT, PCR conditions were: 45 cycles of 95° 1?
Gene_expression (2977r) of SCN9A
11) Confidence 0.54 Published 2010 Journal Human Mutation Section Body Doc Link PMC2966863 Disease Relevance 0 Pain Relevance 0
The PCR product confirming correct splicing was amplified using primers SCN9A-2310f: CCACCCAATGACTGAGGAAT and SCN9A-2977r: GGTTGTTTGCATCAGGGTCT, PCR conditions were: 45 cycles of 95° 1?
Gene_expression (2310f) of SCN9A
12) Confidence 0.54 Published 2010 Journal Human Mutation Section Body Doc Link PMC2966863 Disease Relevance 0 Pain Relevance 0
The PCR product confirming correct splicing was amplified using primers SCN9A-2310f: CCACCCAATGACTGAGGAAT and SCN9A-2977r: GGTTGTTTGCATCAGGGTCT, PCR conditions were: 45 cycles of 95° 1?
Gene_expression (using) of SCN9A
13) Confidence 0.54 Published 2010 Journal Human Mutation Section Body Doc Link PMC2966863 Disease Relevance 0 Pain Relevance 0
The PCR product confirming correct splicing was amplified using primers SCN9A-2310f: CCACCCAATGACTGAGGAAT and SCN9A-2977r: GGTTGTTTGCATCAGGGTCT, PCR conditions were: 45 cycles of 95° 1?
Gene_expression (using) of SCN9A
14) Confidence 0.54 Published 2010 Journal Human Mutation Section Body Doc Link PMC2966863 Disease Relevance 0 Pain Relevance 0
The PCR product confirming correct splicing was amplified using primers SCN9A-2310f: CCACCCAATGACTGAGGAAT and SCN9A-2977r: GGTTGTTTGCATCAGGGTCT, PCR conditions were: 45 cycles of 95° 1?
Gene_expression (2977r) of SCN9A
15) Confidence 0.54 Published 2010 Journal Human Mutation Section Body Doc Link PMC2966863 Disease Relevance 0 Pain Relevance 0
Cloning and expression study of the mouse tetrodotoxin-resistant voltage-gated sodium channel alpha subunit NaT/Scn11a.
Gene_expression (expression) of voltage-gated sodium channel alpha subunit associated with tetrodotoxin and sodium channel
16) Confidence 0.37 Published 2000 Journal Biochem. Biophys. Res. Commun. Section Title Doc Link 10623609 Disease Relevance 0 Pain Relevance 0.33
Evaluation of Electrical Thresholds and Corneal Kindling Acquisition Rates in Scn9a+/+, Scn9a+/N641Y, and Scn9aN641Y/N641Y Littermate Mice
Gene_expression (/) of Scn9aN641Y (N641Y)
17) Confidence 0.25 Published 2009 Journal PLoS Genetics Section Body Doc Link PMC2730533 Disease Relevance 0.25 Pain Relevance 0

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox