INT89594

From wiki-pain
Jump to: navigation, search
Context Info
Confidence 0.54
First Reported 2000
Last Reported 2010
Negated 1
Speculated 2
Reported most in Body
Documents 44
Total Number 46
Disease Relevance 24.08
Pain Relevance 18.62

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

extracellular space (Ccl5) aging (Ccl5) extracellular region (Ccl5)
cell-cell signaling (Ccl5) cytoplasm (Ccl5)
Anatomy Link Frequency
macrophage 2
external 2
lung 2
nerve 2
plasma 1
Ccl5 (Rattus norvegicus)
Pain Link Frequency Relevance Heat
chemokine 875 100.00 Very High Very High Very High
cytokine 104 100.00 Very High Very High Very High
Inflammatory mediators 17 100.00 Very High Very High Very High
opioid receptor 111 99.96 Very High Very High Very High
fluoxetine 235 99.92 Very High Very High Very High
Sciatic nerve 106 99.80 Very High Very High Very High
Desipramine 245 99.62 Very High Very High Very High
antidepressant 225 99.26 Very High Very High Very High
isoflurane 37 98.60 Very High Very High Very High
Inflammation 505 98.44 Very High Very High Very High
Disease Link Frequency Relevance Heat
INFLAMMATION 559 100.00 Very High Very High Very High
Necrosis 36 100.00 Very High Very High Very High
Cancer 35 100.00 Very High Very High Very High
Nervous System Injury 196 99.96 Very High Very High Very High
Endotoxemia 9 99.82 Very High Very High Very High
Adhesions 28 99.76 Very High Very High Very High
Cold Sores 218 99.68 Very High Very High Very High
Injury 123 99.44 Very High Very High Very High
Diabetes Mellitus 290 98.96 Very High Very High Very High
Sepsis 96 98.56 Very High Very High Very High

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
RESULTS: A positive significant correlation was found between the migratory index and the RANTES levels in SF (r=0.48, p=0.006), the RAI (r=0.56, p=0.0001) and pain on VAS (r=0.43, p=0.04).
Gene_expression (levels) of RANTES
1) Confidence 0.54 Published 2000 Journal Scand. J. Rheumatol. Section Body Doc Link 11028841 Disease Relevance 0.08 Pain Relevance 0
Regulated upon activation, normal T-cell expressed and secreted (RANTES) is a small protein and a prototype member of the CC chemokine-beta subfamily with chemoattractant and inflammatory properties.
Gene_expression (expressed) of RANTES in T-cell associated with chemokine and inflammation
2) Confidence 0.52 Published 2006 Journal Int. J. Biol. Markers Section Abstract Doc Link 17177158 Disease Relevance 0.64 Pain Relevance 0.28
The peptide Met-RANTES inhibits CCR1 and CCR5 and is better protected to protein degradation by the added amino acid methionine.
Gene_expression (protected) of Met-RANTES
3) Confidence 0.50 Published 2010 Journal World J Urol Section Body Doc Link PMC2908759 Disease Relevance 0.33 Pain Relevance 0.38
Levels of RANTES were similarly reduced by 43.1% (n.s.).
Gene_expression (Levels) of RANTES
4) Confidence 0.50 Published 2005 Journal Int. Immunopharmacol. Section Abstract Doc Link 16023603 Disease Relevance 0.40 Pain Relevance 0.75
After 4 h of endotoxemia, plasma levels of TNFalpha, IL-1beta, and RANTES were determined.
Spec (determined) Gene_expression (levels) of RANTES in plasma associated with endotoxemia
5) Confidence 0.50 Published 2005 Journal Int. Immunopharmacol. Section Abstract Doc Link 16023603 Disease Relevance 0.38 Pain Relevance 0.66
CONCLUSION: The migratory index correlate to SF levels of RANTES and parameters for joint pain.


Gene_expression (levels) of RANTES in joint
6) Confidence 0.48 Published 2000 Journal Scand. J. Rheumatol. Section Body Doc Link 11028841 Disease Relevance 0.07 Pain Relevance 0
We studied the effect (subchronic administration: 5 days) of HIVgp120, and a few immune-response mediators: regulated upon activation normal T-cell expressed and presumably secreted (RANTES), stromal derived factor-1alpha (SDF-1alpha), macrophage-derived chemokine (MDC), and their combination, on food and water intake in rats, motor control and pain perception.
Gene_expression (expressed) of RANTES in macrophage associated with pain and chemokine
7) Confidence 0.45 Published 2006 Journal Neurosci. Lett. Section Abstract Doc Link 16343773 Disease Relevance 0.37 Pain Relevance 0.30
We used in situ hybridization to study the levels of RANTES expression, one known ligand for CCR5, in the DRG ipsilateral and contralateral to the nerve injury.
Gene_expression (expression) of RANTES in nerve associated with nervous system injury
8) Confidence 0.45 Published 2007 Journal Mol Pain Section Body Doc Link PMC2228278 Disease Relevance 0.74 Pain Relevance 0.03
Like CCR5, RANTES was expressed in small, medium and large sensory neurons (Fig 7B, C).
Gene_expression (expressed) of RANTES in sensory neurons
9) Confidence 0.45 Published 2007 Journal Mol Pain Section Body Doc Link PMC2228278 Disease Relevance 0.70 Pain Relevance 0.06
RANTES expression was absent in the L4/L5 DRG in vehicle treated rats (Fig 7A).
Neg (absent) Gene_expression (expression) of RANTES
10) Confidence 0.45 Published 2007 Journal Mol Pain Section Body Doc Link PMC2228278 Disease Relevance 0.79 Pain Relevance 0.06
We found that after nerve injury, RANTES expression was strongly upregulated in DRG neurons ipsilateral and contralateral to the nerve injury, when compared to sham control tissue.
Gene_expression (expression) of RANTES in nerve associated with nervous system injury
11) Confidence 0.39 Published 2007 Journal Mol Pain Section Body Doc Link PMC2228278 Disease Relevance 0.79 Pain Relevance 0.06
For all experiments, MCP-1, SDF1, RANTES and IP10 were added to the cells in random order, after which capsaicin, high K+ (50 K) and ATP were added.
Gene_expression (added) of RANTES associated with qutenza
12) Confidence 0.39 Published 2007 Journal Mol Pain Section Body Doc Link PMC2228278 Disease Relevance 0.09 Pain Relevance 0.27
The chemokine SDF-1/CXCL12 and its receptor CXCR4 are constitutively expressed by peripheral nerves [3,27-29] and chemokines that activate CCR5 and CXCR3 receptors, such as RANTES and IP-10, are synthesized in association with neuroinflammatory responses [16,30].
Gene_expression (synthesized) of RANTES in peripheral nerves associated with chemokine
13) Confidence 0.39 Published 2007 Journal Mol Pain Section Body Doc Link PMC2228278 Disease Relevance 0.38 Pain Relevance 0.57
For all experiments, the chemokines MCP-1, SDF-1, RANTES and IP-10 were added in random order to the cells, after which capsaicin, high K+(50 mM) and ATP were added to assess the cells' identity and viability, respectively.
Gene_expression (added) of RANTES associated with chemokine and qutenza
14) Confidence 0.39 Published 2007 Journal Mol Pain Section Body Doc Link PMC2228278 Disease Relevance 0.13 Pain Relevance 0.67
The expression of MCP-1, Osteopontin, RANTES, ICAM-1 and VCAM-1 was evaluated by real-time RT-PCR.
Gene_expression (expression) of RANTES
15) Confidence 0.34 Published 2005 Journal BMC Nephrol Section Abstract Doc Link PMC1175090 Disease Relevance 1.40 Pain Relevance 0.04
Expression of mediators regulating macrophage infiltration (MCP-1, osteopontin, RANTES) and adhesion molecules involved in macrophage infiltration (ICAM-1, VCAM-1) was investigated to further elucidate inflammatory pathways in hypertensive and diabetic renal disease: In TGR rats, renal MCP-1 and osteopontin mRNA steady state levels were increased compared to SD controls, as determined by real-time RT-PCR (figure 3A and 3B).
Spec (investigated) Gene_expression (Expression) of RANTES in macrophage associated with inflammation, diabetes mellitus, renal disease, hypertension and adhesions
16) Confidence 0.34 Published 2005 Journal BMC Nephrol Section Body Doc Link PMC1175090 Disease Relevance 1.57 Pain Relevance 0.08
Gene expression of ICAM-1, VCAM-1 and RANTES was unaltered whereas Osteopontin and MCP-1 were induced by hypertension.
Gene_expression (expression) of RANTES associated with hypertension
17) Confidence 0.34 Published 2005 Journal BMC Nephrol Section Abstract Doc Link PMC1175090 Disease Relevance 2.00 Pain Relevance 0.06
RANTES forward primer: GTCGTCTTTGTCACTCGAAGGA, RANTES reverse primer: GATGTATTCTTGAACCCACTTCTTCTC and RANTES probe: CCGCCAAGTGTGTG CCAACCC.
Gene_expression (probe) of RANTES
18) Confidence 0.33 Published 2005 Journal BMC Nephrol Section Body Doc Link PMC1175090 Disease Relevance 0 Pain Relevance 0
RANTES forward primer: GTCGTCTTTGTCACTCGAAGGA, RANTES reverse primer: GATGTATTCTTGAACCCACTTCTTCTC and RANTES probe: CCGCCAAGTGTGTG CCAACCC.
Gene_expression (probe) of RANTES
19) Confidence 0.33 Published 2005 Journal BMC Nephrol Section Body Doc Link PMC1175090 Disease Relevance 0 Pain Relevance 0.05
Expression of various chemokine mRNAs (MCP-3, MIP-1alpha, RANTES, and eotaxin) increased in rats treated with PT1 or PT2 on day 1 and/or day 3.
Gene_expression (Expression) of RANTES associated with chemokine
20) Confidence 0.32 Published 2002 Journal Inhal Toxicol Section Abstract Doc Link 12028805 Disease Relevance 0.23 Pain Relevance 0.09

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox