
From wiki-pain
Revision as of 02:16, 23 September 2012 by Daniel (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search
Context Info
Confidence 0.53
First Reported 2007
Last Reported 2010
Negated 1
Speculated 0
Reported most in Body
Documents 2
Total Number 3
Disease Relevance 0.29
Pain Relevance 0

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

nucleus (Msx2) DNA binding (Msx2) transcription factor binding (Msx2)
cytoplasm (Msx2)
Anatomy Link Frequency
frontal bone 2
limb buds 2
Msx2 (Mus musculus)
Pain Link Frequency Relevance Heat
anesthesia 5 5.00 Very Low Very Low Very Low
midbrain 4 5.00 Very Low Very Low Very Low
imagery 4 5.00 Very Low Very Low Very Low
isoflurane 3 5.00 Very Low Very Low Very Low
vagus nerve 2 5.00 Very Low Very Low Very Low
Pain 1 5.00 Very Low Very Low Very Low
Disease Link Frequency Relevance Heat
Congenital Anomalies 15 78.64 Quite High
Targeted Disruption 55 48.40 Quite Low
Apoptosis 39 44.88 Quite Low
Sprains And Strains 65 18.44 Low Low
Cleft Palate 16 5.00 Very Low Very Low Very Low
Ventricular Heart Septal Defects 8 5.00 Very Low Very Low Very Low
Persistent Truncus Arteriosus 8 5.00 Very Low Very Low Very Low
Body Weight 5 5.00 Very Low Very Low Very Low
Death 2 5.00 Very Low Very Low Very Low
Breast Cancer 2 5.00 Very Low Very Low Very Low

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
Our data indicate that forced expression of Spry1 in Wnt1-Cre expressing cells results in reduced domains of Msx1 and Msx2 expression in craniofacial structures, while expression in the limb buds remains intact albeit at a reduced level.
Negative_regulation (reduced) of Gene_expression (expression) of Msx2 in limb buds
1) Confidence 0.53 Published 2010 Journal BMC Dev Biol Section Body Doc Link PMC2874773 Disease Relevance 0.15 Pain Relevance 0
Spry1;Wnt1-Cre embryos also exhibit a complete absence of the frontal bone; therefore we surmised that Msx1 and Msx2 expression would be reduced or absent.
Negative_regulation (reduced) of Neg (absent) Gene_expression (expression) of Msx2 in frontal bone
2) Confidence 0.39 Published 2010 Journal BMC Dev Biol Section Body Doc Link PMC2874773 Disease Relevance 0.14 Pain Relevance 0
The primers used were Msx2, forward: ggaagaccagatggaccaga, and reverse: tctgtatcaagtggccctgtc; amphiregulin, forward: aaggaggcttcgacaagaaa, and reverse: atccgaaagctccacttcct; and ribosomal protein L19 (a housekeeping gene), forward: atcgccaatgccaactcc, and reverse: tcatccttctcatccaggtca.

Negative_regulation (reverse) of Gene_expression (used) of Msx2
3) Confidence 0.30 Published 2007 Journal Environ Health Perspect Section Body Doc Link PMC1852652 Disease Relevance 0 Pain Relevance 0

General Comments

This test has worked.

Personal tools
