INT206911

From wiki-pain
Revision as of 07:21, 21 September 2012 by Daniel (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search
Context Info
Confidence 0.71
First Reported 2007
Last Reported 2010
Negated 1
Speculated 1
Reported most in Body
Documents 4
Total Number 7
Disease Relevance 1.26
Pain Relevance 0

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

nucleus (Msx2) DNA binding (Msx2) transcription factor binding (Msx2)
cytoplasm (Msx2)
Anatomy Link Frequency
embryos 2
muscle tissue 1
frontal bone 1
limb buds 1
Msx2 (Mus musculus)
Pain Link Frequency Relevance Heat
anesthesia 11 5.00 Very Low Very Low Very Low
midbrain 8 5.00 Very Low Very Low Very Low
imagery 8 5.00 Very Low Very Low Very Low
isoflurane 6 5.00 Very Low Very Low Very Low
vagus nerve 4 5.00 Very Low Very Low Very Low
cytokine 3 5.00 Very Low Very Low Very Low
Inflammation 2 5.00 Very Low Very Low Very Low
Pain 2 5.00 Very Low Very Low Very Low
withdrawal 1 5.00 Very Low Very Low Very Low
Disease Link Frequency Relevance Heat
Targeted Disruption 110 98.08 Very High Very High Very High
Apoptosis 110 96.48 Very High Very High Very High
Sprains And Strains 130 93.12 High High
Cleft Palate 32 91.48 High High
Congenital Anomalies 30 91.08 High High
Infection 28 69.60 Quite High
Hypertrophy 3 56.08 Quite High
Rhinitis 12 46.72 Quite Low
Body Weight 10 25.60 Quite Low
Ventricular Heart Septal Defects 16 5.00 Very Low Very Low Very Low

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
Our data indicate that forced expression of Spry1 in Wnt1-Cre expressing cells results in reduced domains of Msx1 and Msx2 expression in craniofacial structures, while expression in the limb buds remains intact albeit at a reduced level.
Gene_expression (expression) of Msx2 in limb buds
1) Confidence 0.71 Published 2010 Journal BMC Dev Biol Section Body Doc Link PMC2874773 Disease Relevance 0.15 Pain Relevance 0
Spry1;Wnt1-Cre embryos also exhibit a complete absence of the frontal bone; therefore we surmised that Msx1 and Msx2 expression would be reduced or absent.
Neg (absent) Gene_expression (expression) of Msx2 in frontal bone
2) Confidence 0.71 Published 2010 Journal BMC Dev Biol Section Body Doc Link PMC2874773 Disease Relevance 0.14 Pain Relevance 0
We next examined the expression of Msx1 and Msx2 in Spry1;Wnt1-Cre embryos.
Spec (examined) Gene_expression (expression) of Msx2 in embryos
3) Confidence 0.71 Published 2010 Journal BMC Dev Biol Section Body Doc Link PMC2874773 Disease Relevance 0.21 Pain Relevance 0
In addition, the domains of expression of several key transcription factors important to normal craniofacial and cardiac development including AP2, Msx2, Dlx5, and Dlx6 were reduced in Spry1;Wnt1-Cre transgenic embryos.


Gene_expression (expression) of Msx2 in embryos associated with targeted disruption
4) Confidence 0.55 Published 2010 Journal BMC Dev Biol Section Abstract Doc Link PMC2874773 Disease Relevance 0.29 Pain Relevance 0
The expression of Msx2 and amphiregulin mRNAs, two estrogen-regulated genes (Mallepell et al. 2006; Phippard et al. 1996), increased monotonically with increasing doses of E2 in both CD-1 and C57B16 mice (Figure 2 and Table 1).


Gene_expression (expression) of Msx2
5) Confidence 0.54 Published 2007 Journal Environ Health Perspect Section Body Doc Link PMC1852652 Disease Relevance 0.35 Pain Relevance 0
The primers used were Msx2, forward: ggaagaccagatggaccaga, and reverse: tctgtatcaagtggccctgtc; amphiregulin, forward: aaggaggcttcgacaagaaa, and reverse: atccgaaagctccacttcct; and ribosomal protein L19 (a housekeeping gene), forward: atcgccaatgccaactcc, and reverse: tcatccttctcatccaggtca.


Gene_expression (used) of Msx2
6) Confidence 0.47 Published 2007 Journal Environ Health Perspect Section Body Doc Link PMC1852652 Disease Relevance 0 Pain Relevance 0
The up-regulated expression of Msx1 and Msx2 in infected muscle tissue supports the proposal that de-differentiation of infected muscle provides hypertrophic nuclei [9,11].
Gene_expression (expression) of Msx2 in muscle tissue
7) Confidence 0.06 Published 2008 Journal Parasit Vectors Section Body Doc Link PMC2538513 Disease Relevance 0.13 Pain Relevance 0

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox