INT265337

Context Info Confidence 0.35 First Reported 2009 Last Reported 2009 Negated 1 Speculated 0 Reported most in Body Documents 2 Total Number 9 Disease Relevance 1.00 Pain Relevance 0

transport (Smad3) intracellular (Smad3) DNA binding (Smad3) protein complex (Smad3) cytoplasm (Smad3) nucleus (Smad3)

Anatomy Link Frequency MH1 1 Smad3 (Mus musculus)

Pain Link Frequency Relevance Heat Kinase C 1 21.28 ketamine 9 5.00 anesthesia 9 5.00 ischemia 1 5.00 isoflurane 1 5.00 Neurotransmitter 1 5.00

Disease Link Frequency Relevance Heat Repression 56 99.42 Retinal Diseases 2 81.52 Ganglion Cysts 13 63.88 Cytomegalovirus Infection 2 39.20 Targeted Disruption 32 37.52 Apoptosis 37 33.32 Hypoglycemia 8 6.00 Hyperplasia 16 5.00 Injury 16 5.00 Cancer 10 5.00

Sentences Mentioned In

Key:

Protein

Mutation

Event

Anatomy

Negation

Speculation

Pain term

Disease term

Together, these data suggest that, although it is not required for binding to Smad3, the N-terminus of Sox17 is important for repression of Smad3 transcriptional activity.

Smad3 Binding (binding) of associated with repression

1) Confidence 0.35 Published 2009 Journal PLoS ONE Section Body Doc Link PMC2682659 Disease Relevance 0.30 Pain Relevance 0

Thus, Sox17 interaction with these domains is consistent with the antagonistic effects of Sox17 on Smad3 DNA binding and transcriptional activity.

Smad3 Binding (binding) of

2) Confidence 0.35 Published 2009 Journal PLoS ONE Section Body Doc Link PMC2682659 Disease Relevance 0.12 Pain Relevance 0

While both the MAD homology domains (MH1 and MH2) of Smad3 interacted with Sox17 at low stringency binding conditions (data not shown), Smad3 1–145 did not bind to Sox17 under higher stringency conditions (Fig. 7B).

Smad3 Neg (not) Binding (bind) of in MH1

3) Confidence 0.27 Published 2009 Journal PLoS ONE Section Body Doc Link PMC2682659 Disease Relevance 0 Pain Relevance 0

Since Sox17 negatively regulated Smad3 transcriptional activity in reporter assays but did not influence Smad3 nuclear import, we sought to determine if the repression was mediated by influencing Smad3 DNA binding.

Smad3 Binding (binding) of associated with repression

4) Confidence 0.27 Published 2009 Journal PLoS ONE Section Body Doc Link PMC2682659 Disease Relevance 0.26 Pain Relevance 0

While that amino acids 129–359 of Sox17 appear to mediate binding to Smad3, the N-terminus of Sox17 is necessary to antagonize Smad3 activity.

Smad3 Binding (binding) of

5) Confidence 0.27 Published 2009 Journal PLoS ONE Section Body Doc Link PMC2682659 Disease Relevance 0.11 Pain Relevance 0

In addition, Sox17 physically interacted with Smad3 and negatively regulated Smad3 DNA binding and TGF-?

Smad3 Binding (binding) of

6) Confidence 0.26 Published 2009 Journal PLoS ONE Section Body Doc Link PMC2682659 Disease Relevance 0 Pain Relevance 0

Further, Sox17 interacted with Smad3 and blocked Smad3 DNA binding and transcriptional activity.

Smad3 Binding (binding) of

7) Confidence 0.26 Published 2009 Journal PLoS ONE Section Abstract Doc Link PMC2682659 Disease Relevance 0 Pain Relevance 0

Both of the Sox17 truncations and the point mutant maintained the ability to interact with Smad3 across multiple binding stringencies (Fig. 7C).

Smad3 Binding (interact) of

8) Confidence 0.26 Published 2009 Journal PLoS ONE Section Body Doc Link PMC2682659 Disease Relevance 0 Pain Relevance 0

Primer pairs (Invitrogen) used were smad2 (For: CGGAGATTCTAACAGAACTG; Rev: TGCTTGAGCATCGCACTGAA), smad3 (For: AGCACACAATAACTTGGACC; Rev: TAAGACACACTGGAACAGCGGATG), TGF-?

smad3 Binding (pairs) of

9) Confidence 0.21 Published 2009 Journal PLoS ONE Section Body Doc Link PMC2659748 Disease Relevance 0.20 Pain Relevance 0

General Comments

This test has worked.