INT336615

From wiki-pain
Revision as of 21:04, 22 September 2012 by Daniel (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search
Context Info
Confidence 0.76
First Reported 2010
Last Reported 2010
Negated 1
Speculated 0
Reported most in Body
Documents 1
Total Number 47
Disease Relevance 35.16
Pain Relevance 0.78

This is a graph with borders and nodes. Maybe there is an Imagemap used so the nodes may be linking to some Pages.

extracellular space (Fbln1) extracellular region (Fbln1) proteinaceous extracellular matrix (Fbln1)
extracellular matrix organization (Fbln1)
Anatomy Link Frequency
SK-BR-3 2
lung 2
smooth muscle cells 1
Fbln1 (Mus musculus)
Pain Link Frequency Relevance Heat
corticosteroid 188 99.92 Very High Very High Very High
Inflammation 141 99.40 Very High Very High Very High
Immobilon 47 79.44 Quite High
cytokine 47 78.96 Quite High
anesthesia 47 77.08 Quite High
fibrosis 47 74.04 Quite High
imagery 47 68.92 Quite High
ketamine 47 51.76 Quite High
Thoracotomy 47 50.96 Quite High
Disease Link Frequency Relevance Heat
Asthma 4465 99.84 Very High Very High Very High
Fibrosarcoma 47 99.62 Very High Very High Very High
Breast Cancer 94 99.60 Very High Very High Very High
INFLAMMATION 141 99.40 Very High Very High Very High
Injury 1645 99.04 Very High Very High Very High
Airway Remodeling 376 99.04 Very High Very High Very High
Occupational Lung Diseases 658 98.92 Very High Very High Very High
Wound Healing 235 95.40 Very High Very High Very High
Fibrosis 47 74.04 Quite High
Cancer 47 72.64 Quite High

Sentences Mentioned In

Key: Protein Mutation Event Anatomy Negation Speculation Pain term Disease term
decreased FBLN-1D mRNA expression (figure 2D) was consistent with the findings of Laprise et al., who reported reduced FBLN-1D mRNA expression in lysates from asthma derived bronchial biopsies compared with those derived from non-asthmatics [15].
Gene_expression (expression) of FBLN-1D mRNA associated with asthma and occupational lung diseases
1) Confidence 0.76 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0.91 Pain Relevance 0
Detection of fibulin-1 and fibronectin in airway smooth muscle cells
Gene_expression (Detection) of fibulin-1 in smooth muscle cells
2) Confidence 0.76 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0 Pain Relevance 0
If, as our results in the present study suggest, FBLN-1 is implicated in airway remodeling, then the lack of effect of corticosteroids on levels of FBLN-1 in-vivo highlights the need for treatments that target the structural changes which contribute to airway remodeling in asthma.
Gene_expression (levels) of FBLN-1 associated with asthma, corticosteroid and airway remodeling
3) Confidence 0.76 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0.68 Pain Relevance 0.13
decreased FBLN-1D mRNA expression (figure 2D) was consistent with the findings of Laprise et al., who reported reduced FBLN-1D mRNA expression in lysates from asthma derived bronchial biopsies compared with those derived from non-asthmatics [15].
Gene_expression (expression) of FBLN-1D mRNA associated with asthma and occupational lung diseases
4) Confidence 0.76 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 1.02 Pain Relevance 0
FBLN-1C expression in the ECM was suppressed by AO treatment and ASM cells were reseeded on the ECM as previously described [6].
Gene_expression (expression) of FBLN-1C
5) Confidence 0.76 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0.93 Pain Relevance 0
To enable the comparison of the basal level of FBLN-1, the levels of FBLN-1 were normalized against the positive control, whole cell lysates of the SK-BR-3 human breast carcinoma cell line.


Gene_expression (levels) of FBLN-1 in SK-BR-3 associated with breast cancer
6) Confidence 0.76 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0.16 Pain Relevance 0
UUUUCUCUUGGCGGAAGCUGCAGA) were used in equal parts to silence the expression of FBLN-1 in the mice, and a scrambled AO (5?
Gene_expression (expression) of FBLN-1
7) Confidence 0.76 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0 Pain Relevance 0.10
FBLN-1 is expressed as a percentage of the FBS standard.


Gene_expression (expressed) of FBLN-1
8) Confidence 0.76 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0 Pain Relevance 0
As a strong, specific signal for FBLN-1 was detectable in FBS this was used as a positive control for these experiments.
Gene_expression (detectable) of FBLN-1
9) Confidence 0.76 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0 Pain Relevance 0.04
The aim of this study was to assess the production of FBLN-1C by asthmatic and non-asthmatic volunteers, and further, to determine its function in isolated cell systems, and in an in vivo model of airway hyperresponsiveness.


Gene_expression (production) of FBLN-1C associated with asthma
10) Confidence 0.76 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0.90 Pain Relevance 0.03
Levels of FBLN-1 in the ECM were the same in unstimulated non-asthmatic and asthmatic ECM (figure 4A).
Gene_expression (Levels) of FBLN-1 associated with asthma
11) Confidence 0.76 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 1.28 Pain Relevance 0.03
To produce ECM with suppressed FBLN-1C expression, ASM cells were seeded in 75 cm2 flasks and transfected as described above.
Gene_expression (produce) of FBLN-1C
12) Confidence 0.76 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0 Pain Relevance 0
In addition, Laprise et al., reported reduced FBLN-1D expression in asthma derived bronchial biopsies compared with those derived from non-asthmatics [15].
Gene_expression (expression) of FBLN-1D associated with asthma and occupational lung diseases
13) Confidence 0.76 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0.56 Pain Relevance 0.03
As a positive control, 25 µg of SK-BR-3, a human breast carcinoma cell line known to express FBLN-1 (Abgent, San Diego, CA, USA) was used.
Gene_expression (express) of FBLN-1 in SK-BR-3 associated with breast cancer
14) Confidence 0.76 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0.10 Pain Relevance 0
FBLN-1 expression has been reported in human lung tissue using microarray technology, however, FBLN-1 was not verified by PCR or at the protein level, nor were functional studies carried out [15], [16], [17].
Gene_expression (expression) of FBLN-1 in lung
15) Confidence 0.76 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0.58 Pain Relevance 0.04
The regulated expression of FBLN-1 downstream of inflammation and its regulation of the remodeling/AHR axis identify the therapeutic potential of targeting this glycoprotein.
Gene_expression (expression) of FBLN-1 associated with inflammation
16) Confidence 0.66 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0.66 Pain Relevance 0.13
Data obtained ex-vivo showed that FBLN-1 protein levels and FBLN-1C mRNA levels in ASM cells derived from asthmatics were higher than those derived from non-asthmatics.
Gene_expression (levels) of FBLN-1C mRNA associated with occupational lung diseases
17) Confidence 0.66 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 0.84 Pain Relevance 0
Fibulin-1 is not involved in migration of asthma derived ASM
Neg (not) Gene_expression (involved) of Fibulin-1 associated with asthma
18) Confidence 0.66 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 1.60 Pain Relevance 0
ASM cell derived soluble FBLN-1 levels from the two patient groups were not different, either basally or after stimulation with TGF?
Gene_expression (levels) of FBLN-1
19) Confidence 0.66 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 1.48 Pain Relevance 0
increased FBLN-1 deposition in the ECM from asthmatic ASM cells (P<0.01, figure 4B).
Gene_expression (deposition) of FBLN-1 associated with asthma
20) Confidence 0.66 Published 2010 Journal PLoS ONE Section Body Doc Link PMC2954173 Disease Relevance 1.31 Pain Relevance 0.03

General Comments

This test has worked.

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox